-
PurposeTargeted CpG methylation
-
Depositing Lab
-
Depositing OrganizationBaylor College of Medicine
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89633 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 89633-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 89633-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerinvitrogene
- Backbone size w/o insert (bp) 5382
- Total vector size (bp) 11637
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersNeomycin (select with G418) ; EGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesite-specific DNA-methyltransferase SssI
-
Alt namedCas9-MQ1(Q147L)
-
Insert Size (bp)1164
- Promoter CMV
-
Tags
/ Fusion Proteins
- 3*FLAG (N terminal on insert)
- 6*His (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (destroyed during cloning)
- 3′ cloning site NheI (destroyed during cloning)
- 5′ sequencing primer GCGCCCTAGGGACAGCAAAGTGGAGAACAAAACA
- 3′ sequencing primer GCGCCCTAGGGCCGCCGATCTTGTCAATG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 89633-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 89633-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-dCas9-MQ1(WT)-EGFP was a gift from Margaret Goodell (Addgene plasmid # 89633 ; http://n2t.net/addgene:89633 ; RRID:Addgene_89633) -
For your References section:
Targeted DNA methylation in vivo using an engineered dCas9-MQ1 fusion protein. Lei Y, Zhang X, Su J, Jeong M, Gundry MC, Huang YH, Zhou Y, Li W, Goodell MA. Nat Commun. 2017 Jul 11;8:16026. doi: 10.1038/ncomms16026. 10.1038/ncomms16026 PubMed 28695892