Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLV hUbC-dCas9-MQ1(Q147L)-EGFP
(Plasmid #89793)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89793 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLV hUbC-dCas9-T2A-GFP (#53191)
  • Backbone size w/o insert (bp) 14759
  • Total vector size (bp) 15923
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    EGFP; Zeo marker is outside the LTRs and will not be packaged into virus.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    site-specific DNA-methyltransferase SssI
  • Alt name
    dCas9-MQ1(Q147L)
  • Species
    Synthetic; Spiroplasma sp. (strain MQ1)
  • Insert Size (bp)
    1164
  • Mutation
    Q147L, CAA-->CTA
  • GenBank ID
    P15840.3
  • Promoter hUbC
  • Tags / Fusion Proteins
    • 3*FLAG (N terminal on insert)
    • T2A-EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (destroyed during cloning)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer GCGCCCTAGGGACAGCAAAGTGGAGAACAAAACA
  • 3′ sequencing primer GCGCCCTAGGGCCGCCGATCTTGTCAATG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV hUbC-dCas9-MQ1(Q147L)-EGFP was a gift from Margaret Goodell (Addgene plasmid # 89793 ; http://n2t.net/addgene:89793 ; RRID:Addgene_89793)
  • For your References section:

    Targeted DNA methylation in vivo using an engineered dCas9-MQ1 fusion protein. Lei Y, Zhang X, Su J, Jeong M, Gundry MC, Huang YH, Zhou Y, Li W, Goodell MA. Nat Commun. 2017 Jul 11;8:16026. doi: 10.1038/ncomms16026. 10.1038/ncomms16026 PubMed 28695892