Skip to main content

Lenti-sgNT3/Cre
(Plasmid #89654)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89654 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLL3.3
  • Backbone size w/o insert (bp) 7741
  • Vector type
    Mammalian Expression, Lentiviral, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    non-targeting gRNA
  • gRNA/shRNA sequence
    CCGCGCCGTTAGGGAACGAG
  • Species
    M. musculus (mouse)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-sgNT3/Cre was a gift from Monte Winslow (Addgene plasmid # 89654 ; http://n2t.net/addgene:89654 ; RRID:Addgene_89654)
  • For your References section:

    A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo. Rogers ZN, McFarland CD, Winters IP, Naranjo S, Chuang CH, Petrov D, Winslow MM. Nat Methods. 2017 May 22. doi: 10.1038/nmeth.4297. 10.1038/nmeth.4297 PubMed 28530655