This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLenti-EGFP-hChibby1
(Plasmid #89770)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89770 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEF1α-IRES-EGFP
  • Backbone manufacturer
    gift from Dr. Lemischka, Mount Sinai Medical Center, New York, NY
  • Backbone size w/o insert (bp) 10000
  • Total vector size (bp) 10380
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Chibby1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    380
  • Entrez Gene
    CBY1 (a.k.a. C22orf2, CBY, Chibby1, HS508I15A, PGEA1, PIGEA-14, PIGEA14, arb1)
  • Promoter EF1alpha
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer ACCACATGGTCCTTCTTCAG (GFP primer)
  • 3′ sequencing primer ACGCCACGTTGCCTGACAAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-EGFP-hChibby1 was a gift from Ken-Ichi Takemaru (Addgene plasmid # 89770 ; http://n2t.net/addgene:89770 ; RRID:Addgene_89770)