pLenti-EGFP-hChibby1
(Plasmid
#89770)
-
PurposeLabels mother centrioles/basal bodies
-
Depositing Lab
-
Depositing OrganizationStony Brook University
Located in the United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89770 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEF1α-IRES-EGFP
-
Backbone manufacturergift from Dr. Lemischka, Mount Sinai Medical Center, New York, NY
- Backbone size w/o insert (bp) 10000
- Total vector size (bp) 10380
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChibby1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)380
-
Entrez GeneCBY1 (a.k.a. C22orf2, CBY, Chibby1, HS508I15A, PGEA1, PIGEA-14, PIGEA14, arb1)
- Promoter EF1alpha
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer ACCACATGGTCCTTCTTCAG (GFP primer)
- 3′ sequencing primer ACGCCACGTTGCCTGACAAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-EGFP-hChibby1 was a gift from Ken-Ichi Takemaru (Addgene plasmid # 89770 ; http://n2t.net/addgene:89770 ; RRID:Addgene_89770)