LP110a
(Plasmid #90199)

• Purpose: pEGFP-N1 with cDNA encoding full length HsKIF13A
• Depositing Lab: Lotte Pedersen
• Publication: Schou et al Nat Commun. 2017 Jan 30;8:14177. doi: 10.1038/ncomms14177.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 10010
• Modifications to backbone: None
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: KIF13A
• Species: H. sapiens (human)
• Insert Size (bp): 5310
• Mutation: full length protein, no mutations
• GenBank ID: NM_001105566.2
• Entrez Gene: KIF13A (a.k.a. RBKIN, bA500C11.2)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: CMV-F: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: EGFP_N: CGTCGCCGTCCAGCTCGACCA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry