-
PurposeA YFP-based chloride sensor with enhanced chloride sensitivity, photostability and reduced pH interference. The sequence of mClY is EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K.
-
Depositing Lab
-
Depositing OrganizationYale University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 90457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 90457-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 90457-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEYFP N1
- Backbone size w/o insert (bp) 4013
- Total vector size (bp) 4733
-
Modifications to backboneNone
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemClY-N1
-
Alt namemonomeric Cl-YFP
-
SpeciesH. sapiens (human), M. musculus (mouse), R. norvegicus (rat)
-
Insert Size (bp)720
-
MutationEYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K.
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GGAGGTTTTTTAAAGCAAGTA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 90457-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 90457-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mClY-N1 was a gift from Joseph Santos-Sacchi (Addgene plasmid # 90457 ; http://n2t.net/addgene:90457 ; RRID:Addgene_90457) -
For your References section:
A genetically-encoded YFP sensor with enhanced chloride sensitivity, photostability and reduced ph interference demonstrates augmented transmembrane chloride movement by gerbil prestin (SLC26a5). Zhong S, Navaratnam D, Santos-Sacchi J. PLoS One. 2014 Jun 5;9(6):e99095. doi: 10.1371/journal.pone.0099095. eCollection 2014. PONE-D-13-54352 [pii] PubMed 24901231
Map uploaded by the depositor.
