pADH118-17
(Plasmid
#91727)
-
PurposeNAT-marked C. albicans URA3-specific gRNA expression construct; part 2 of 2 of C.alb LEUpOUT CRISPR system. Use with pADH137 CAS9 expression construct.
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Merced
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 91727 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2242
- Total vector size (bp) 4152
-
Selectable markersNourseothricin (NAT)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNAT 2of2, pSNR52, C. albicans URA3-specific gRNA, LEU2 2of2
-
gRNA/shRNA sequenceC. albicans URA3 (GTAGTTGAAGGATTAAAACA)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pADH118-17 was a gift from Aaron Hernday (Addgene plasmid # 91727 ; http://n2t.net/addgene:91727 ; RRID:Addgene_91727) -
For your References section:
An Efficient, Rapid, and Recyclable System for CRISPR-Mediated Genome Editing in Candida albicans. Nguyen N, Quail MMF, Hernday AD. mSphere. 2017 Apr 26;2(2):e00149-17. doi: 10.1128/mSphereDirect.00149-17. eCollection 2017 Mar-Apr. 10.1128/mSphereDirect.00149-17 PubMed 28497115