pACYC_HA-ZmSAE1_ZmSAE2-FLAG
(Plasmid #91944)

• Purpose: Bacterial expression of maize SAE1 and SAE2
• Depositing Lab: Richard Vierstra
• Publication: Augustine et al Plant Physiol. 2016 Jul;171(3):2191-210. doi: 10.1104/pp.16.00353. Epub 2016 May 15.

Backbone

• Vector backbone: pACYCDuet-1
• Backbone size w/o insert (bp): 4008
• Total vector size (bp): 6984
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: HA-ZmSAE1
• Species: Zea mays
• Insert Size (bp): 1035
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: GGATCTCGACGCTCTCCCT
• 3′ sequencing primer: GATTATGCGGCCGTGTACAA

Gene/Insert 2

• Gene/Insert name: ZmSAE2-FLAG
• Species: Zea mays
• Insert Size (bp): 1941
• Tag / Fusion Protein:
  • FLAG (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (unknown if destroyed)
• 3′ cloning site: KpnI (unknown if destroyed)
• 5′ sequencing primer: TGTACACGGCCGCATAATC
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry