pmCitrine_N1
(Plasmid
#92420)
-
PurposeEmpty backbone for C-terminal fusion of mCitrine
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92420 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEGFP-N1 series
-
Backbone manufacturerCloneTech
-
Modifications to backboneReplaced the GFP for synthetic mCitrine
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCitrine
-
Alt namemonomeric YFP analog citrine
-
SpeciesSynthetic
- Promoter CMV
-
Tag
/ Fusion Protein
- mCitrine (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TAACAACTCCGCCCCATT
- 3′ sequencing primer GTCCAGCTCGACCAGGATGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmCitrine_N1 was a gift from Geert van den Bogaart (Addgene plasmid # 92420 ; http://n2t.net/addgene:92420 ; RRID:Addgene_92420) -
For your References section:
Fluorescence lifetime imaging microscopy reveals rerouting of SNARE trafficking driving dendritic cell activation. Verboogen DRJ, Gonzalez Mancha N, Ter Beest M, van den Bogaart G. Elife. 2017 May 19;6. pii: e23525. doi: 10.7554/eLife.23525. 10.7554/eLife.23525 PubMed 28524818