pMGF130
(Plasmid #96971)

• Purpose: S. pombe lem2 knockout cassette with hygro resistance gene
• Depositing Labs: Adam Frost, Wesley Sundquist
• Publication: Gu et al Proc Natl Acad Sci U S A. 2017 Mar 14;114(11):E2166-E2175. doi: 10.1073/pnas.1613916114. Epub 2017 Feb 27.

Backbone

• Vector backbone: pGEM GST vector
• Backbone size w/o insert (bp): 4800
• Total vector size (bp): 7500
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: lem2
• Species: S. pombe (fission yeast)
• Insert Size (bp): 2700
• Mutation: whole ORF deletion and replaced with hygro resistance gene
• Entrez Gene: lem2 (a.k.a. SPAC18G6.10, heh1)
• Promoter: N/A

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTCGACATCGCTGGAAGCAAC
• 3′ sequencing primer: ATCCATAGTGTCGAACCCTTC

Resource Information

• Supplemental Documents:
  • pMGF130-pGEM-GST-pp-lem2-Hyg-KO-casette.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry