Skip to main content
Addgene
Open Menu

px330_Rosa_sgRNA
(Plasmid #97007)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 97007 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 97007-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 97007-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 8489
  • Total vector size (bp) 8509
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rosa26 sgRNA
  • gRNA/shRNA sequence
    ACTGGAGTTGCAGATCACGA
  • Species
    M. musculus (mouse)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GTTTCGCCACCTCTGACTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid contains a Cas9 gene and a Rosa26-specific sgRNA for CRISPR/Cas9 mediated targeting of large cassettes into the mouse Rosa26 locus.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px330_Rosa_sgRNA was a gift from Russell Ray (Addgene plasmid # 97007 ; http://n2t.net/addgene:97007 ; RRID:Addgene_97007)

  • For your References section:

    A CRISPR toolbox for generating intersectional genetic mouse models for functional, molecular, and anatomical circuit mapping. Lusk SJ, McKinney A, Hunt PJ, Fahey PG, Patel J, Chang A, Sun JJ, Martinez VK, Zhu PJ, Egbert JR, Allen G, Jiang X, Arenkiel BR, Tolias AS, Costa-Mattioli M, Ray RS. BMC Biol. 2022 Jan 28;20(1):28. doi: 10.1186/s12915-022-01227-0. 10.1186/s12915-022-01227-0 PubMed 35086530
Related items:
Commonly requested with: