Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDonor MCS Rosa26
(Plasmid #37200)


Item Catalog # Description Quantity Price (USD)
Plasmid 37200 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pZDonor AAVS1
  • Backbone manufacturer
  • Total vector size (bp) 4524
  • Modifications to backbone
    mouse Rosa26 targeting arms were PCR amplified and cloned in as described in the manuscript.
  • Vector type
    Genomic targeting - zinc finger

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number

Gene/Insert 1

  • Gene/Insert name
    Rosa26 left targeting arm
  • Species
    M. musculus (mouse)
  • Insert Size (bp)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer M13_pUC-fwd
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name

Gene/Insert 3

  • Gene/Insert name
    Rosa26 right targeting arm
  • Insert Size (bp)

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer NA
  • 3′ sequencing primer M13_pUC-rev
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Depositor Comments

The homology arms in the ROSA26 donor vector were generated by PCR of mouse genomic DNA and insertion of the PCR-amplified right homology arm (left primer: 5-TTATTGCGGCCGCAG ATGGGCGGGAGTCTTCT-3, right primer: 5-AACA CCGCGGCAGTTTATAAATGGAGAAAAAGGAGA -3) between the NotI and SacII sites and the left homology arm (left primer: 5-TCTATGGTACCAGTTAACGGCA GCCGGAGT-3 , right primer: 5 -CGGACGAATTCTCT AGAAAGACTGGAGTTGCAGA-3) between the KpnI and EcoRI sites in the pZDonor AAVS1 vector obtained from Sigma–Aldrich.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDonor MCS Rosa26 was a gift from Charles Gersbach (Addgene plasmid # 37200 ; ; RRID:Addgene_37200)
  • For your References section:

    Gene targeting to the ROSA26 locus directed by engineered zinc finger nucleases. Perez-Pinera P, Ousterout DG, Brown MT, Gersbach CA. Nucleic Acids Res. 2012 Apr 1;40(8):3741-52. Epub 2011 Dec 14. 10.1093/nar/gkr1214 PubMed 22169954