pINDUCER-21-LCOR-P2A-HOXA9-T2A-HOXA5
(Plasmid #97044)

• Purpose: Expresses LCOR, P2A, HOXA9, T2A and HOXA5 in mammalian cells. *Please see notes below on P2A cleaving efficiency.
• Depositing Lab: George Daley
• Publication: Sugimura et al Nature. 2017 May 17. doi: 10.1038/nature22370.

Backbone

• Vector backbone: pINDUCER-21
• Backbone manufacturer: Stephen Elledge, Thomas Westbrook
• Backbone size w/o insert (bp): 12152
• Total vector size (bp): 13411
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: GFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Ligand Dependent Nuclear Receptor Corepressor, Runt-related transcription factor 1, ETS-related gene
• Alt name: LCOR, HOXA9, HOXA5 seperated by a 2A peptide
• Species: H. sapiens (human)
• Promoter: Tet on

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: AGCTCGTTTAGTGAACCGTCAGATC
• 3′ sequencing primer: TCTGGGACGTCGTATGGGTA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: due to an unforeseen error in the original publication describing the minimal P2A self-cleaving peptide [https://www.pnas.org/content/106/13/5449], the expressed transgenes are not effectively cleaved. A new version of this plasmid has been redesigned with the corrected self-cleaving sequence. The new version is available through Addgene as Plasmid 154088: pINDUCER-21-LCOR-P2A-HOXA9-T2A-HOXA5-IMPROVED.