Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #97039)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 97039 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Stephen Elledge, Thomas Westbrook
  • Backbone size w/o insert (bp) 12152
  • Total vector size (bp) 11257
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy


  • Gene/Insert name
    Spi-1 Proto-Oncogene
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    SPI1 (a.k.a. OF, PU.1, SFPI1, SPI-1, SPI-A)
  • Promoter Tet on

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer TCTGGGACGTCGTATGGGTA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pINDUCER-21-SPI1 was a gift from George Daley (Addgene plasmid # 97039 ; ; RRID:Addgene_97039)
  • For your References section:

    Haematopoietic stem and progenitor cells from human pluripotent stem cells. Sugimura R, Jha DK, Han A, Soria-Valles C, da Rocha EL, Lu YF, Goettel JA, Serrao E, Rowe RG, Malleshaiah M, Wong I, Sousa P, Zhu TN, Ditadi A, Keller G, Engelman AN, Snapper SB, Doulatov S, Daley GQ. Nature. 2017 May 17. doi: 10.1038/nature22370. 10.1038/nature22370 PubMed 28514439