-
PurposeExpresses RUNX1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 97043 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepINDUCER-21
-
Backbone manufacturerStephen Elledge, Thomas Westbrook
- Backbone size w/o insert (bp) 12152
- Total vector size (bp) 11908
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRunt Related Transcription Factor 1
-
Alt nameRUNX1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1443
-
Entrez GeneRUNX1 (a.k.a. AML1, AML1-EVI-1, AMLCR1, CBF2alpha, CBFA2, EVI-1, PEBP2aB, PEBP2alpha)
- Promoter Tet on
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer TCTGGGACGTCGTATGGGTA
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene NGS results found that the RUNX1 translation continues into and past the attB2 site, resulting in extra amino acids LPTFLYKVVDIQHSGGRSSLEGPRFE at the C-terminus of the protein, before the HA tag. The depositing laboratory states that this is an expected addition to the protein
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pINDUCER-21-RUNX1 was a gift from George Daley (Addgene plasmid # 97043 ; http://n2t.net/addgene:97043 ; RRID:Addgene_97043) -
For your References section:
Haematopoietic stem and progenitor cells from human pluripotent stem cells. Sugimura R, Jha DK, Han A, Soria-Valles C, da Rocha EL, Lu YF, Goettel JA, Serrao E, Rowe RG, Malleshaiah M, Wong I, Sousa P, Zhu TN, Ditadi A, Keller G, Engelman AN, Snapper SB, Doulatov S, Daley GQ. Nature. 2017 May 17. doi: 10.1038/nature22370. 10.1038/nature22370 PubMed 28514439