His-MBP-NRBF2
(Plasmid #99330)

• Purpose: Mammalian expression of NRBF2, which associates with the PI3KC3-C1 complex
• Depositing Lab: James Hurley
• Publication: Young et al Proc Natl Acad Sci U S A. 2016 Jul 19;113(29):8224-9. doi: 10.1073/pnas.1603650113. Epub 2016 Jul 6.

Backbone

• Vector backbone: 1M
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Nuclear receptor-binding factor 2
• Alt name: NRBF2
• Species: H. sapiens (human)
• GenBank ID: NP_110386.2
• Entrez Gene: NRBF2 (a.k.a. COPR, COPR1, COPR2, NRBF-2)
• Promoter: T7
• Tag / Fusion Protein:
  • His-MBP (N terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: MBP_1010F: 5�- ccgctttctggtatgccgtgcg
• 3′ sequencing primer: T7-Term

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid contains His-MBP-TEVsite-full NRBF2.

IMPORT NOTES: Special character found in field(5-prime Sequencing Primer)