pcDNA4/TO h-Stx3 L165A/E166A-2xMyc/His
(Plasmid #99743)

• Purpose: Expresses human Stx3 locked into the open conformation with a C-term myc-myc-his tag in mammalian cells.
• Depositing Lab: Thomas Weimbs
• Publication: Giovannone et al Mol Biol Cell. 2017 Oct 15;28(21):2843-2853. doi: 10.1091/mbc.E17-07-0461. Epub 2017 Aug 16.

Backbone

• Vector backbone: pcDNA4
• Backbone manufacturer: Thermo Fisher
• Backbone size w/o insert (bp): 5075
• Total vector size (bp): 5909
• Vector type: Mammalian Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Stx3
• Alt name: Stx3A
• Alt name: Stx3 isoform 1
• Species: H. sapiens (human)
• Insert Size (bp): 834
• Mutation: Changed both L165 and E166 to Alanine
• GenBank ID: NM_004177.4
• Entrez Gene: STX3 (a.k.a. DIAR12, MVID2, RDMVID, STX3A)
• Promoter: CMV
• Tag / Fusion Protein:
  • myc-myc-his (C terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: acgcaaatgggcggtaggcgtg
• 3′ sequencing primer: tagaaggcacagtcgaggctg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry