Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV-KrasG13R/sgKras/Cre
(Plasmid #99858)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 99858 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    388-MCS AAV
  • Backbone size w/o insert (bp) 5958
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kras
  • gRNA/shRNA sequence
    GACTGAGTATAAACTTGTGG
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2014
  • Mutation
    AvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutations (GACTGAGTATAAACTTGTGGTGG>GACTGAGTATAAACTAGTAGTCG), G13R mutation (GGC>CGC), Barcode = (AGGCAAGAGCGCCTTGACGATA>AGGTAAATCGGCTCTGACTATC), BsiWI site (CGTGCG>CGTACG)
  • Entrez Gene
    Kras (a.k.a. AI929937, K-Ras, K-Ras 2, K-ras, Ki-ras, Kras-2, Kras2, c-K-ras, c-Ki-ras, p21B, ras)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI, AvrII (not destroyed)
  • 3′ cloning site BsiWI, XhoI (not destroyed)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-KrasG13R/sgKras/Cre was a gift from Monte Winslow (Addgene plasmid # 99858 ; http://n2t.net/addgene:99858 ; RRID:Addgene_99858)
  • For your References section:

    Multiplexed in vivo homology-directed repair and tumor barcoding enables parallel quantification of Kras variant oncogenicity. Winters IP, Chiou SH, Paulk NK, McFarland CD, Lalgudi PV, Ma RK, Lisowski L, Connolly AJ, Petrov DA, Kay MA & Winslow MM. Nature Communications 8: 2053 (2017) 10.1038/s41467-017-01519-y