We narrowed to 4,215 results for: spl
-
Plasmid#256439PurposeMammalian expression of a human codon optimized Cas7/11 with cloning site for spacer under U6 promoterDepositorInsertCas7/11-2A-BFP
ExpressionMammalianPromoterEf1a/U6Available sinceJuly 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBTK1212
Plasmid#251993PurposeDouble-stranded RNA biomolecular fluorescence complementation sensor for bacteria, induced by arabinose. Variant of pDS-BiFC7 with AmpR.DepositorInsertSplit mVenus (YFP) fused to mutant B2 dsRNA-binding domains (RBDs)
UseBiosensorExpressionBacterialPromoterPBADAvailable sinceFeb. 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-GBKT7
Plasmid#248655PurposeEmpty vector for generating yeast 2-hybrid GAL4 DNA binding domain fusion constructs by Gateway cloning. It may also be used as an empty vector experimental control.DepositorTypeEmpty backboneUseYeast 2-hybridTagsGAL4 binding domain, MycExpressionYeastAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
phU6-LaTranC-sgRNA
Plasmid#246933Purposefor HEK293T human cell genome editingDepositorInsertLaTranC sgRNA
UseCRISPRAvailable sinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEffector-LaTranC-CRISPR RNA
Plasmid#246928Purposefor E.coli plasmid interference and PAM depletion assaysDepositorInsertLaTranC
UseUnspecifiedAvailable sinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
1167A
Plasmid#218233PurposeHDR plasmid for inserting Ceratitis capitata transformer female intron into the white pupae geneDepositorInsertputative metabolite transport protein
ExpressionInsectAvailable sinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD043
Plasmid#212913PurposeEncodes the S. cerevisiae 111 amino acid SCW4 Translational Fusion Partner Sequence as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertSCW4 (SCW4 Budding Yeast)
ExpressionBacterialAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD084
Plasmid#212921PurposeEncodes the HA-tagged S. cerevisiae Tip1p yeast surface display anchor protein as a Type 4a part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertTIP1 (TIP1 Budding Yeast)
ExpressionBacterialAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD041
Plasmid#212911PurposeEncodes the S. cerevisiae YAR066W Translational Fusion Partner Sequence as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertYAR066W (YAR066W Budding Yeast)
ExpressionBacterialAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD044
Plasmid#212914PurposeEncodes the S. cerevisiae 142 amino acid SCW4 Translational Fusion Partner Sequence as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertSCW4 (SCW4 Budding Yeast)
ExpressionBacterialAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD009
Plasmid#212906PurposeEncodes S. cerevisiae SRL1 pre- signal peptide as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertSRL1 (SRL1 Budding Yeast)
ExpressionBacterialAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
mTB3-FLAG tag
Plasmid#210204PurposeType 3 phage-display vector that contains kanamycin resistance and displays the FLAG-tag at the N-terminus of mature protein III.DepositorInsertFLAG-tag
ExpressionBacterialAvailable sinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ASPSCR1_METRNL
Plasmid#205775PurposeExpress mEGFP-tagged fusion protein, ASPSCR1_METRNL from patient-derived sequenceDepositorAvailable sinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAXY0011
Plasmid#205580PurposeNpuDnaE(C)_KAN(193-265)_RUBYDepositorInsertNpuDnaE(C)
ExpressionPlantPromoter35SAvailable sinceOct. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAXY0010
Plasmid#205579PurposeKAN(1-192)-NpuDnaE(N)_GFPuvDepositorInsertNpuDnaE(N)
ExpressionPlantPromoter35SAvailable sinceOct. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAXY0009
Plasmid#205578PurposeNpuDnaE(C)_KAN(132-265)_RUBYDepositorInsertNpuDnaE(C)
ExpressionPlantPromoter35SAvailable sinceOct. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAXY0008
Plasmid#205577PurposeKAN(1-131)-NpuDnaE(N)_GFPuvDepositorInsertNpuDnaE(N)
ExpressionPlantPromoter35SAvailable sinceOct. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAXY0018
Plasmid#205587Purposep3flag_HygR(1-52)-NpuDnaE(N)DepositorInsertHygR-NpuDnaE(N)_homo-codon-OP
Tags3xFLAGExpressionMammalianPromoterCMV IE94Available sinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only