We narrowed to 6,978 results for: hwa
-
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
XE253 pCDNA3.1(zeo)-hDsh3-82-716
Plasmid#16756DepositorAvailable SinceMarch 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
CABE-T2.6
Plasmid#193263PurposeExpression of CABE-T2.6 base editor in mammalian cells, CMV promoterDepositorInsertCABE-T2.6
ExpressionMammalianMutationD10A (Cas9), TadA mutations withinPromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
821 pGEX2T PTEN 1-274
Plasmid#10741DepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
CBE-T1.6
Plasmid#193275PurposeExpression of CBE-T1.6 base editor in mammalian cells, CMV promoterDepositorInsertCBE-T1.6
ExpressionMammalianMutationD10A (Cas9), TadA mutations withinPromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUAST-HA, Pbl-A
Plasmid#69792PurposePebble isoform A in P element-based pUAST vector for Gal4-regulated expression in Drosophila.DepositorInsertPebble - Drosophila guanine nucleotide exchange factor
UseP element-based puast vector for gal4-regulated e…TagsHA tagExpressionInsectMutationEncodes Pbl (NP_729306.1) lacking last 9 amino ac…Promoterhsp70 promoterAvailable SinceNov. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEN_TGmiR_Gb2-K
Plasmid#25766PurposeEntry vector withTRE promoter driving mouse G beta 2 miR30-based shRNA with GFP coexpression.DepositorAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pUC19-A0LWB3
Plasmid#103070PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertA0LWB3(Cas9 coding gene from Acidothermus cellulolyticus (strain ATCC 43068 / 11B))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 D444-500
Plasmid#19839DepositorInsertMKL1 D444-500 (MRTFA Human)
Tags3xFLAGExpressionMammalianMutationdeleted amino acids 444-500Available SinceMarch 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
His10-B1 Integrin
Plasmid#186139PurposeFor expression of recombinant his10-beta1 integrin cytosolic domain in bacteriaDepositorAvailable SinceJune 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgp27#1
Plasmid#102759PurposeExpresses sgRNA targeting mouse p27DepositorAvailable SinceNov. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
814 pSG5L HA PTEN 1-336
Plasmid#10742DepositorAvailable SinceSept. 27, 2005AvailabilityAcademic Institutions and Nonprofits only -
pMXs-EGFP-Rheb-HVR HRas-IP
Plasmid#13833DepositorInsertRheb-HVR HRas (Rheb Mouse)
UseRetroviralTagsEGFPExpressionMammalianMutationN-terminal of Rheb and hyper variable region (HVR…Available SinceMarch 16, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 T450A
Plasmid#19843DepositorInsertMKL1 T450A (MRTFA Human)
Tags3xFLAGExpressionMammalianMutationchanged Threonine 450 to AlanineAvailable SinceDec. 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
pUC19-K1LM04
Plasmid#103119PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertK1LM04(Cas9 coding gene from Bergeyella zoohelcum ATCC 43767)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
XE254 pCDNA3.1(zeo)-hDsh3-497-716
Plasmid#16755DepositorAvailable SinceMarch 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2-coHPDL WT 3xFlag-V5
Plasmid#174129PurposeExpresses codon-optimized HPDL with a 3xFlag-V5 tag in mammalian cellsDepositorInsert4-hydroxyphenylpyruvate dioxygenase like (HPDL Human)
UseLentiviralTags3xFLAG-V5ExpressionMammalianMutationCodon optimizedAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19-E6I4Q5
Plasmid#103101PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertE6I4Q5(Cas9 coding gene from Enterococcus faecalis TX0012)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 D500-630
Plasmid#19841DepositorInsertMKL1 D500-630 (MRTFA Human)
Tags3xFLAGExpressionMammalianMutationdeleted amino acids 500-630Available SinceMarch 16, 2009AvailabilityAcademic Institutions and Nonprofits only