We narrowed to 8,966 results for: aav
-
Plasmid#208101PurposeBiosensor for intracellular L-lactateDepositorInsertR-diLACCO1
UseAAVAvailable sinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-mtIF3 shRNA_TagRFP657
Plasmid#182367PurposeshRNA targeting mtIF3 mRNADepositorAvailable sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR(RfxCas13d)-CAG-hfCas13d-pa
Plasmid#233036PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d from a CAG promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d
UseAAVAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
aav-CAG-FLEX-tdNfsB(F124W)-mCherry (eNTR)
Plasmid#113762PurposeAAV-mediated conditional expression of bacterial tdNfsB-mCherry (eNTR) under the CAG promoterDepositorInserttdNfsB(F124W)-mCherry
UseAAV and Cre/LoxTagsmCherryExpressionMammalianMutationF124WPromoterCAGAvailable sinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
(pRZ60) AAV: U6-gRNA(cs1)-EF1a-eGFP
Plasmid#254582PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and capture sequence in scaffold and eGFP from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable sinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ76) AAV: U6-gRNA(cs1)-EF1a-mCherry
Plasmid#254583PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and capture sequence in scaffold and mCherry from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9
Plasmid#190903PurposeAAV-KamiCas9 vector expressing expressing thew GFP reporter gene and sgHTT and sgCas9DepositorAvailable sinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pTH-iCre-WPREpA
Plasmid#213130PurposeTruncated rat TH promoter expressing iCreDepositorInsertiCre
UseAAV and Mouse TargetingTagsNoneExpressionMammalianPromoterTruncated TH promoter from rat (Rattus norvegicus…Available sinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-pMagHigh-FlpC
Plasmid#180586PurposePA-FlpDepositorInsertSplit FlpO
UseAAVAvailable sinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-GCaMP6m-p2A-ChRmine-Kv2.1-WPRE
Plasmid#258884PurposeDox-inducible AAV expression of GCaMP6m-P2A-soma-targeted ChRmineDepositorInsertGCaMP6m
UseAAVTagsP2A-ChRmineExpressionMammalianPromoterTREAvailable sinceJuly 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1584 - pscAAV CMV-IE secreted EGFP-THPKTEL WPRE
Plasmid#188539PurposeAn AAV packaging vector that expresses secreted C-CDNF under control of the EGFP promoter.DepositorInsertsecreted EGFP
UseAAVTagsCDNF(1-28) and THPKTEL WPREPromoterCMV-IEAvailable sinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBK1312-AAV-EFSNC-dSaCas9-KRAB
Plasmid#223157PurposeExpression of KRAB with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB
UseAAV and CRISPRTags3xFLAGExpressionMammalianPromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-H2GH
Plasmid#182202PurposeAdeno-associated viral vector to express histone2B-HaloTag-GFP fusion, a nuclear-localized Halotag-GFP fusion constructDepositorInserthistone2B-HaloTag-GFP
UseAAVAvailable sinceMay 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MPRA-MluI-SpeI-EcoRI
Plasmid#190196PurposeEmpty vector for inserting MPRA libraries into AAVDepositorTypeEmpty backboneUseAAV; Massively parallel reporter assay (mpra)ExpressionMammalianAvailable sinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-PytR(PyOtR)-mCherry
Plasmid#204870PurposeExpresses pyrrolysyl tRNA variant "PyOtR" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertM. mazei pyrrolysyl tRNA mutant "PyOtR"
UseAAVExpressionMammalianMutationU25C; A3G, A4C, A5G, C6G, G63C, T65G, T66CPromoterU6Available sinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FRT-JEDI-1P-Kv-WPRE
Plasmid#202617PurposeGenetically encoded voltage indicator (GEVI) JEDI-1P flanked by FRT in AAV production vector expressed under the mammalian promoter (EF1a), FLP recombinase-dependentDepositorInsertFRT-JEDI-1P-Kv
UseAAV; Flp/frtExpressionMammalianPromoterEF1aAvailable sinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/5'USS-GFP
Plasmid#197884PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre and the leakage expression is reduced without CreDepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV N-SpyCas9-Intein, U6-gRNA scaffold (F+E)
Plasmid#120293PurposeAAV Vector for expression of N-terminal SpyCas9 fragment with Intein and a U6-driven F+E gRNA scaffoldDepositorInsertN-terminal fragment of SpyCas9
UseAAV and CRISPRTagsSV40-NLS and split-inteinExpressionMammalianAvailable sinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
(pRZ318) AAV: U6-gRNA(FLEX)-EF1a-mScarlet
Plasmid#254587PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and 10x FLEX preferred scaffold and mScarlet from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only