We narrowed to 17,031 results for: sgRNA
-
Plasmid#202824PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the CDK5RAP2 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete SVA within CDK5RAP2 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA Oct4A -12
Plasmid#50921PurposeU6 driven sgRNA targeting OCT4 isoform A -12 bp from TSSDepositorAvailable sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGG426_UV5
Plasmid#165608PurposeVector for expression of the SpCas9 VRKG variant with sgRNA in E. coli: lacUV5-VRKG(SpCas9, D1135V/S1136R/D1332K/R1333G) and UV5-sgRNA (hEGFP spacer)DepositorInsertlacUV5 driving Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G) and hEGFP-sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialMutationD1135V, S1136R, D1332K and R1333G mutations in Sp…PromoterlacUV5 driving Cas9 VRKG and UV5 driving sgRNAAvailable sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpyA-GFP
Plasmid#220189PurposesgRNA expression vector - pEM7 promoter with GFP in sgRNA siteDepositorInsertpEM7 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpEM7Available sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpyD-GFP
Plasmid#220192PurposesgRNA expression vector - pBG28 promoter with GFP in sgRNA siteDepositorInsertpBG28 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpBG28Available sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCJH026_proD_Cas12c-multiplexing_CAM
Plasmid#183073PurposePlasmid expressing a Cas12c sgRNA targeting GFP and another sgRNA targeting RFP in one transcript for testing multiplexed repressionDepositorInsertExpressing two Cas12c sgRNAs (targeting GFP or RFP) in one transcript
UseCRISPRExpressionBacterialAvailable sinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA Oct4A -158
Plasmid#50922PurposeU6 driven sgRNA targeting OCT4 isoform A -158 bp from TSSDepositorAvailable sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
BLADE-182
Plasmid#134914PurposesgRNA targeting GFP to be used in nanoblade systemDepositorInsertGFP
UseCRISPR and Synthetic BiologyPromoterU6Available sinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJZC101
Plasmid#62335PurposesgRNA (no RNA aptamer addition) with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
ULK1 KO sgRNA
Plasmid#207561PurposepX330 expressing Cas9 and a sgRNA targeting the ULK1 locusDepositorInsertCCCGCCTGCGCCATGGAGCC
ExpressionMammalianPromoterCMV and U6Available sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG16L1 sgRNA
Plasmid#207563PurposepX330 expressing Cas9 and a sgRNA targeting the ATG16L1 locusDepositorInsertGCAGCAAGTGACATGTCGTC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA with rpr-1 promoter
Plasmid#48961Purposeto drive the sgRNA expression under RNase P non-coding RNA promoterDepositorPublicationTypeEmpty backboneUseCRISPRExpressionWormPromoterrpr-1 promoterAvailable sinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAT9679-sgRNA-BFP
Plasmid#162988PurposesgRNA cloning plasmidDepositorInsertexchangeable cassette
UseCRISPRExpressionBacterial and MammalianPromoterU6Available sinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lentiGuide-Puro-PJY390
Plasmid#251159PurposeCloning backbone for guide RNAs compatible with 10x FLEXDepositorPublicationInsertSpCas9 sgRNA F+E
UseCRISPR and LentiviralPromoterEF1aAvailable sinceJune 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro-P2A-EGFP-PJY392
Plasmid#251161PurposeCloning backbone for guide RNAs compatible with 10x FLEXDepositorPublicationInsertSpCas9 sgRNA F+E
UseCRISPR and LentiviralPromoterEF1aAvailable sinceJune 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgNTC_#2-hygro
Plasmid#254677Purposeknockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable sinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgNTC_#1-hygro
Plasmid#254676Purposeknockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable sinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA103
Plasmid#245325PurposeCas9 CRISPRa positive control guide; targets CD47DepositorAvailable sinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 PAPOLA_sg2
Plasmid#244862PurposeKnockout of human PAPOLADepositorAvailable sinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 PAPOLA_sg1
Plasmid#244861PurposeKnockout of human PAPOLADepositorAvailable sinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only