We narrowed to 5,443 results for: mag
-
Plasmid#242573PurposeGateway destination vector with a CAGGS promoter in the backbone.DepositorTypeEmpty backboneUseGateway CloningAvailable sinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pNK189
Plasmid#219743PurposeMoClo-compatible Level 0 promoterless vector encoding mutant of Neonothopanus nambi hispidin-3-hydroxylase nnH3H_v2 codon-optimised for expression in Homo sapiensDepositorInsertmutant of fungal hispidin-3-hydroxylase
UseSynthetic BiologyMutationD37E, V181I, S323M, M385KAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK4169
Plasmid#219744PurposeMoClo-compatible Level 0 promoterless vector encoding mutant of Neonothopanus nambi hispidin-3-hydroxylase nnH3H_v2 codon-optimised for expression in Pichia pastorisDepositorInsertmutant of fungal hispidin-3-hydroxylase
UseSynthetic BiologyMutationD37E, V181I, S323M, M385KAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA Display Part 1-4 DO
Plasmid#206514PurposeCcdB Dropout vector for parts 1-4 of Hemagglutinin surface expression in mammalian cellsDepositorTypeEmpty backboneTags3X-FLAG; Strep-Tag II; HRV 3C cut site; PDGFR-B T…ExpressionMammalianPromoterCMV promoterAvailable sinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28b-TREER
Plasmid#208321PurposeBacterial expression of the His-tagged peptide TREER.DepositorInsertTREER
TagsDBCO-Tag, His-TagExpressionBacterialAvailable sinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28b-PuRRRE
Plasmid#208323PurposeBacterial expression of the His-tagged peptide PuRRRE.DepositorInsertPuRRRE
TagsDBCO-Tag, His-TagExpressionBacterialAvailable sinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
XLone-mARG2
Plasmid#173792PurposeMammalian acoustic reporter gene 1 cassette 2 on XLone plasmidDepositorInsertGvpN, F G L S K J U
TagsGFPExpressionMammalianPromoterTRE3G promoterAvailable sinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
IRE-miR21mutant-SunTag-TREAT
Plasmid#196933PurposeSunTag cassette was added in the coding region in the miR21mutant -IRE-TREAT reporter.DepositorInsertRenilla luciferase
ExpressionBacterial and MammalianAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
IRE-let7-SunTag-TREAT
Plasmid#196926PurposeSunTag cassette was added in the coding region in the let7-IRE-TREAT reporterDepositorInsertRenilla luciferase
ExpressionBacterial and MammalianAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
IRE-let7R-SunTag-TREAT
Plasmid#196927PurposeSunTag cassette was added in the coding region in the let7R-IRE-TREAT reporter.DepositorInsertRenilla luciferase
ExpressionBacterial and MammalianAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGE010-Target1 (Mpphot)
Plasmid#186728PurposeBinary vector for CRISPR/Cas9 (target 1: Mpphot [positive control]) in plants (for Agrobacterium-mediated genetic transformation).DepositorInsertMphot
ExpressionBacterialAvailable sinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-FRT-2xtTA
Plasmid#191205PurposeFlpo dependent tTA expression under the control of TRE promotorDepositorInsert2xtTA
UseAAVExpressionMammalianPromoterTREAvailable sinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE010-Target2 (Mpphot)
Plasmid#186729PurposeBinary vector for CRISPR/Cas9 (target 2: Mpphot [negative control]) in plants (for Agrobacterium-mediated genetic transformation).DepositorInsertMphot
ExpressionBacterialAvailable sinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target2 (Mpphot)
Plasmid#186727PurposeGateway entry vector for sgRNA (target 2: Mpphot [negative control]). Transient expression of sgRNA (target 2: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
ExpressionBacterialAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target1 (Mpphot)
Plasmid#186726PurposeGateway entry vector for sgRNA (target 1: Mpphot [positive control]). Transient expression of sgRNA (target 1: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
ExpressionBacterialAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET51b_SNAP-ecDHFRmt
Plasmid#187109PurposeExpression of SNAP-ecDHFRmt fusion in bacteriaDepositorInsertSNAP-ecDHFRmt
TagsHisx10 and StrepExpressionBacterialMutationecDHFR-R44L-H45QPromoterT7Available sinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_345
Plasmid#180550PurposeEntry vector containing eforRedDepositorInserteforRed
ExpressionBacterialAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only