Lentiviral expression of human MYCN

Supression of shcircHUWE1(19,20)_1 expression

a phytochrome-based near-infrared fluorescent protein, also known as iRFP713, used for in vivo imaging

Expresses anti-mouse nanobody fused with Tn5

Mammalian Expression of mEGFP-SQSTM1 WT Fusion Protein

Cas9 driven by double 35S, nptII for plant selection, I-PpoI site to accept gRNA from pUC gRNA Shuttle

Dox-inducible lentiviral vector expressing SV40 large T antigen for immortalizing cells

Ready-to-use AAV1 particles produced from pAAV_hSyn-DIO-PdCO-mScarlet-WPRE (#198511). In addition to the viral particles, you will also receive purified pAAV_hSyn-DIO-PdCO-mScarlet-WPRE plasmid DNA. Syn-driven Cre-dependent expression of optimized PdCO in frame with mScarlet. These AAV preparations are suitable purity for injection into animals.

Scrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)

Expression plasmid for expressing circular RNAs of a desired sequence

Expresses HBV polymerase in mammalian cells

pcDNA3.1-ACE2-GFP

Localization of mGreenLantern fluorescent protein to clathrin

Ready-to-use AAV1 particles produced from pAAV-EF1a-C-CreintG (#69571). In addition to the viral particles, you will also receive purified pAAV-EF1a-C-CreintG plasmid DNA. EF1a-driven expression of optimized C-terminal component of Cre recombinase dependent on GFP (Cre-DOG OPT); to be coinjected with pAAV-EF1a-N-CretrcintG (Addgene catalog# 69570) and GFP (or for use with transgenic GFP animals). These AAV preparations are suitable purity for injection into animals.

Ready-to-use AAV1 particles produced from pAAV-EF1a-N-CretrcintG (#69570). In addition to the viral particles, you will also receive purified pAAV-EF1a-N-CretrcintG plasmid DNA. EF1a-driven expression of optimized N-terminal component of Cre recombinase dependent on GFP (Cre-DOG OPT); to be coinjected with pAAV-EF1a-C-CreintG (Addgene catalog# 69571) and GFP (or for use with transgenic GFP animals). These AAV preparations are suitable purity for injection into animals.

Expresses OsTIR1 under the control of the CMV promoter

Mini-transposon donor plasmid for V. cholerae CAST system. pUC19 vector backbone.