pCDH-EF1-FHC
(Plasmid #64874)

• Purpose: (Empty Backbone) lentiviral vector with Flag, HA tags
• Depositing Lab: Richard Wood
• Publication: Yousefzadeh et al PLoS Genet. 2014 Oct 2;10(10):e1004654. doi: 10.1371/journal.pgen.1004654. eCollection 2014 Oct.

Backbone

• Vector backbone: pCDH-CMV-MCS-EF1-Puro
• Backbone manufacturer: System Biosciences
• Modifications to backbone: Addition of FLAG and HA tags
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin
• Tags / Fusion Proteins:
  • Flag (C terminal on backbone)
  • HA (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: EF1a-F_alt (gccgtgaacgttctttttc)
• 3′ sequencing primer: IRES-R (CCTCACATTGCCAAAAGACG)

Resource Information

• Articles Citing this Plasmid:
  • 21 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Information for Cloning Grade DNA (Catalog # 64874-DNA.cg) ( Back to top )

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

• Amount: 2 µg
• Guaranteed Concentration: 100 ng/µl +/- 5 ng/µl
• Pricing: $105 USD
• Storage: DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here