Skip to main content
Holiday Schedule: Addgene will be closed December 23 - December 30. Order processing and shipping will resume on January 2, 2023. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #64874)


Item Catalog # Description Quantity Price (USD)
Plasmid 64874 Standard format: Plasmid sent in bacteria as agar stab 1 $75
Cloning Grade DNA 2 µg of cloning grade DNA in Tris buffer 1 $95

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    System Biosciences
  • Modifications to backbone
    Addition of FLAG and HA tags
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
  • Tags / Fusion Proteins
    • Flag (C terminal on backbone)
    • HA (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer EF1a-F_alt (gccgtgaacgttctttttc)
  • 3′ sequencing primer IRES-R (CCTCACATTGCCAAAAGACG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Information for Cloning Grade DNA (Catalog # ( Back to top )


Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.


  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $95 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-EF1-FHC was a gift from Richard Wood (Addgene plasmid # 64874 ; ; RRID:Addgene_64874)
  • For your References section:

    Mechanism of suppression of chromosomal instability by DNA polymerase POLQ. Yousefzadeh MJ, Wyatt DW, Takata K, Mu Y, Hensley SC, Tomida J, Bylund GO, Doublie S, Johansson E, Ramsden DA, McBride KM, Wood RD. PLoS Genet. 2014 Oct 2;10(10):e1004654. doi: 10.1371/journal.pgen.1004654. eCollection 2014 Oct. PGENETICS-D-14-01461 [pii] PubMed 25275444