Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCDH-EF1-FHC-POLQ
(Plasmid #64875)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64875 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCDH-EF1-FHC
  • Backbone manufacturer
    Wood Lab, Addgene plasmid 64874
  • Total vector size (bp) 15236
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    POLQ
  • Species
    H. sapiens (human)
  • Entrez Gene
    POLQ (a.k.a. PRO0327)
  • Promoter EF1alpha
  • Tags / Fusion Proteins
    • FLAG (C terminal on backbone)
    • HA (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer EF1a-F_alt (gccgtgaacgttctttttc)
  • 3′ sequencing primer IRES-R (CCTCACATTGCCAAAAGACG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-EF1-FHC-POLQ was a gift from Richard Wood (Addgene plasmid # 64875 ; http://n2t.net/addgene:64875 ; RRID:Addgene_64875)
  • For your References section:

    Mechanism of suppression of chromosomal instability by DNA polymerase POLQ. Yousefzadeh MJ, Wyatt DW, Takata K, Mu Y, Hensley SC, Tomida J, Bylund GO, Doublie S, Johansson E, Ramsden DA, McBride KM, Wood RD. PLoS Genet. 2014 Oct 2;10(10):e1004654. doi: 10.1371/journal.pgen.1004654. eCollection 2014 Oct. PGENETICS-D-14-01461 [pii] PubMed 25275444