We narrowed to 8,655 results for: mcherry
-
Plasmid#250167PurposeNeuronal overexpression of synaptophysin fused to mCherryDepositorAvailable sinceMarch 25, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pU6-(BsaI)_CBh-Cas9-T2A-mCherry
Plasmid#135012PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
Tags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianPromoterCBhAvailable sinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHAGE-dCas9-mCherry-CRY2
Plasmid#249579PurposeLentiviral vector for stable expression of dCas9-mCherry-CRY2hiclu fusion protein in mammalian cellsDepositorInsertsCRY2hiclu
Sp dCas9
UseLentiviralTagsmCherryExpressionMammalianMutationCatalytically dead mutant Cas9PromoterCMVAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPB-shMiro1-mCherry-CAAX
Plasmid#228741PurposeMembrane-tethered mCherry shRNA targeting Miro1DepositorAvailable sinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mCherry-Jph3 WPRE
Plasmid#236237PurposeAAV expression of human Junctophilin3 N-terminally tagged with mCherryDepositorAvailable sinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJK2020
Plasmid#171932Purposeexpress MS2 coat protein (MCP) fused to superfolder GFP and histone subunit H2B fused to mCherry in an operonDepositorInsertPmex-5::MS2 Coat Protein::linker::sfGFP::tbb-2 3'UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3'UTR
Tagssuperfolder GFP, mCherryExpressionWormPromoter-Available sinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CALPAIN-7-mCherry
Plasmid#180652PurposeLentiviral expression vector for CALPAIN-7. Used for generating cell lines. Has C-terminal mCherry tag. Dox-inducible. Internal ID: WISP20-50.DepositorInsertCALPAIN-7
UseLentiviralTagsmCherryExpressionMammalianMutationsiRNA resistant to: GCACCCAUACCUUUACAUUAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pME-mCherry-PA-Rac1
Plasmid#169042PurposeMiddle entry vector for Gateway cloning that contains an mCherry fused with an optimized photoactivatable Rac1 gene insertDepositorInsertPA-Rac-1 (RAC1 Avena sativa (oat), Human)
UseGateway entry cloning vectorTags6X His and Fused with mCherryMutationRac1 starts at I4 and contains mutations Q61L, E9…Available sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FKBP-TPD52
Plasmid#172456PurposeExpression of Tumor Protein D52 (TPD52) with N-terminal mCherry-FKBP tagDepositorAvailable sinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
Stx3-mCherry
Plasmid#190890PurposeExpresses syntaxin 3 fused to mCherry in mammalian cellsDepositorAvailable sinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-CT-Tagging
Plasmid#165869PurposeTemplate for amplification of mcherry C-terminal tagging cassetteDepositorInsertVector - CT Tagging
UseSynthetic BiologyAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-NT-Tagging
Plasmid#165870PurposeTemplate for amplification of mCherry N-terminal tagging cassetteDepositorInsertVector - NT Tagging
UseSynthetic BiologyAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBZ202-pU6-sgBFP-An_CBh-sv40NLS-Cas9-Sa163RT-NLS-T2A-mCherry
Plasmid#170184PurposeExpression vector for a sgRNA against BFP and spCas9-Sa163 RT fusion protein linked to mCherry via a T2A peptide. Donor template An was inserted in the Retron Sa163 msr-msd region by SpeI and AvrII.DepositorInsertsSa163 RT
Retron Sa163 msr-msd
BFP-to-GFP conversion donor template An
UseCRISPRTagsNLSExpressionMammalianPromoterCBh and hU6Available sinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIRES Hygro3 LifeAct-mChe
Plasmid#64343PurposeBicistronic expression of LifeAct-mCherry fusion and Hygro resistance geneDepositorInsertLifeAct
TagsIRES-Hygro and mCherryExpressionMammalianPromoterCMVAvailable sinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
JDW 1061 (pLenti6.2_CMV_GATA1_P2A_H2A_mCherry)
Plasmid#233543PurposeA CMV driven human GATA1 followed by a P2A cleavage peptide and an H2A mCherry fusion protein.DepositorPublicationAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmCherry_I3
Plasmid#239340PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with mCherry in mammalian cells. Assembles into nanocages tagged with 60 FPs.DepositorInsertI3-01
TagsmCherryExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKK-BI16-TEV-mCherry
Plasmid#105800PurposeConcomitant expression of two proteins. One protein is expressed with mCherry fusion tag (at the C-terminus), cleavable by TEV protease; second tag introduced by user.DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-mCherryExpressionMammalianAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-PytR(A2.1)-mCherry
Plasmid#204869PurposeExpresses pyrrolysyl tRNA variant "A2.1" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertM. mazei pyrrolysyl tRNA mutant "A2.1"
UseAAVExpressionMammalianMutationU25C; A3G, A4G, T65C, T66C, T67TPromoterU6Available sinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CamkII-bPac(WT)-mCherry-minWPRE.sbd
Plasmid#118278PurposeExpresses bPAC(WT)-mCherry under a minimal CamKII PromoterDepositorInsertbPAC(WT)
UseAAVTagsmCherry and mycPromoterCamKIIAvailable sinceJune 18, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by