CMV-mCherry-3’UTR of β-actin-(F30-2xdBroccoli)6
(Plasmid #190162)

• Purpose: Expresses 24 Broccoli-tagged beta-actin mRNA in mammalian cells
• Depositing Lab: Samie Jaffrey
• Publication: Li et al Angew Chem Int Ed Engl. 2020 Mar 9;59(11):4511-4518. doi: 10.1002/anie.201914576. Epub 2020 Jan 28.

Backbone

• Vector backbone: pcDNA 3
• Backbone size w/o insert (bp): 3872
• Total vector size (bp): 7872
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mcherry_(3'UTR, No Actin)_24Broccoli
• Species: H. sapiens (human)
• Insert Size (bp): 3982
• Promoter: CMV
• Tag / Fusion Protein:
  • 24×Broccoli (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: ApaI (not destroyed)
• 5′ sequencing primer: AAATGGGCGGTAGGCGTG
• 3′ sequencing primer: ccagtttggaacaagagtccac

Resource Information

• Supplemental Documents:
  • CMV-mCherry-3’UTR of β-actin-(F30-2xdBroccoli)6.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry