We narrowed to 14,313 results for: 11
-
Plasmid#13470DepositorInsertMKP-1DCH2A (Dusp1 Mouse)
TagsEGFPExpressionMammalianMutationDeletion of MKP-1 CH2A; contains aa 47-367Available sinceDec. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
pWay21-MKP-1DCH2B
Plasmid#13471DepositorInsertMKP-1DCH2B (Dusp1 Mouse)
TagsEGFPExpressionMammalianMutationDeletion of MKP-1 CH2B; Delta 47-137Available sinceDec. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
myc GbetaL mutant 7
Plasmid#8481DepositorPublicationAvailable sinceApril 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
myc GbetaL mutant 2
Plasmid#8478DepositorPublicationAvailable sinceApril 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
pMGE-T7
Plasmid#153021PurposeSingle-plasmid multi-gene expression system. Each genes under the control of a T7 and the lacO promoter sequences.DepositorTypeEmpty backboneExpressionBacterialPromoterT7Available sinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pReporter_12
Plasmid#60572PurposeA reporter plasmid containing the attB and attP sites flanking a green fluorescent protein reporter gene (gfp).DepositorInsertReporter_12
ExpressionBacterialPromoterBBa_J23119Available sinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pReporter_4
Plasmid#60565PurposeA reporter plasmid containing the attB and attP sites flanking a green fluorescent protein reporter gene (gfp).DepositorInsertReporter_4
ExpressionBacterialPromoterBBa_J23119Available sinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLpC-Zipp.-L-IFP-F[1]+Plum (mammalian)
Plasmid#52907PurposeBinary retroviral pl. (puromycin). Zipper (PacI/ClaI):Linker (GGGGS)X2+IFP-F[1]. In the second MCS, the Plum fluorescent protein is cloned in between PmeI/SalI. Confers ampicillin resistance to DH5α.DepositorInsertZipp.-L-IFP-F[1]+Plum
UseRetroviralTagsL-IFP-F[1]ExpressionMammalianPromoterUnknownAvailable sinceJune 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
PLK3 1-334-pEGFP
Plasmid#23266DepositorAvailable sinceDec. 20, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAB168
Plasmid#101671PurposeOpto-T7RNAP*(563-F1), equal expr.DepositorInsertOpto-T7RNAP*(563-F1), equal expr.
UseSynthetic BiologyExpressionBacterialAvailable sinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCJH027_SC101_pLAC_LbCas12a_Kan
Plasmid#183074PurposeWild-type LbCas12a (Chen et al., 2018) in a plasmid containing a SC101 origin and lac promoter for in vivo interference assay.DepositorInsertLbCas12a
ExpressionBacterialMutationWild-typeAvailable sinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pODN-mNG-ANLN
Plasmid#183834PurposeRepair template for the N-terminal tagging of anillin with mNeonGreen in human cells using CRISPR/Cas9.DepositorInsertANLN homology arms with mNeonGreen-linker (ANLN Human)
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-RHOA_sgRNA
Plasmid#183878PurposepX459V2.0-HypaCas9 plasmid with RHOA sgRNA for N-terminal tagging of RhoA in human cells.DepositorAvailable sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1-hPREP
Plasmid#179387PurposeExpress human prolyl oligopeptidase (tagged) in bacterial cellsDepositorAvailable sinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-Tollip M240A,F241A
Plasmid#178051PurposeGFP fused to human Tollip cDNA carrying mutations in the CUE domain. Localisation and expression in mammalian cells.DepositorInsertToll-Interacting Protein (TOLLIP Human)
TagsGFPExpressionMammalianMutationChanged Methionine 240 to Alanine and changed Phe…PromoterCMVAvailable sinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Flag-M4-AR-W741C
Plasmid#171247PurposeMammalian expression of 3xFlag-tagged human androgen receptor mutant that binds to bicalutamide: AR-Trp741Cys (AR-W741C)DepositorInsert3xFlag-tagged human androgen receptor Trp741Cys mutant (AR Human)
TagsFlagExpressionMammalianMutationAR-Trp741Cys (AR-W741C)PromoterCMVAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-TEV-U1AF37MF77M
Plasmid#168267PurposeExpresses human dmU1A with the F37M/F77M double mutantDepositorInsertU1A RRM1 crystallization module (SNRPA Human)
Tags6xHis tag N-terminus, TEV protease cleavage siteExpressionBacterialMutationchanged F37M and F77MPromoterT7 promotorAvailable sinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2+-H2B-pr-mEosFP
Plasmid#141101PurposeH2B fused to pr-mEosFP for chromatin visualization and primed conversionDepositorInsertHistone 2B
Tagspr-mEosFPExpressionMammalianPromotersimian CMV IE94Available sinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRI006-pYFAC-riboB-PgpdA-dSpCas9-VPR-TtrpC
Plasmid#140199PurposeEpisomal expression of dSpCas9-VPR. Filamentous fungi vector with AMA1 and riboB selection marker.DepositorInsertdSpCas9-VPR
UseCRISPR and Synthetic Biology; Expression in asper…TagsVPR (VP64-p65-Rta), NLSPromoterPgpdAAvailable sinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only