We narrowed to 6,562 results for: nls
-
Plasmid#29289PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPle193 (SLC6A3 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable sinceSept. 1, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAV1 for Split-PE, SpCas9 nickase (PKC1001)
Plasmid#190111PurposeAAV1 for expression of nickase SpCas9(H840A) for Split-PE useDepositorInsertnSpCas9
UseAAVTagsbpNLSMutationH840APromoterEF1aAvailable sinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGAPDH-Cre-HYG
Plasmid#231510PurposeExpresses Cre recombinase in AcanthamoebaDepositorInsertCre recombinase
UseUnspecified; Acanthamoeba castellanii neff strainTagsEGFP and SV40 NLSPromoterAcanthamoeba GAPDHAvailable sinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pC131: pAAV.CMV-CasRx-VEGFA sgRNA array
Plasmid#203444PurposePlasmid expressing active RfxCas13d with an array of three VEGFA mRNA targeting gRNAsDepositorInsertsU6-VEGFA sgRNA array
RfxCas13d
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAT9748-dCBE
Plasmid#163008Purposeplasmid expressing CBE with dCas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCBE
UseCRISPRTags3xFLAG and SV40 NLSExpressionMammalianPromoterEF1-aAvailable sinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN4(TA)-ires-puro
Plasmid#167830PurposeControl sensor for EKAREN4DepositorInsertEKAREN4(TA)
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable sinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti-VRERRA-P2A-GFP-PGK-Puro
Plasmid#110865PurposeLentiviral vector for constitutive expression of Cas9-VRERRA-P2A-GFP in mammalian cells (codon optimized)DepositorInsertCas9-VRERRA
UseLentiviralTagsFLAGMutationD1135V, G1218R, R1335E, T1337R, and NLS sequence …PromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX391 Sphaerochaeta globus str. Buddy Cas9
Plasmid#68328PurposeSphaerochaeta globus str. Buddy Cas9DepositorInsertSgCas9
UseCRISPRTagsHA and NLSExpressionMammalianPromoterCMVAvailable sinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-ePhi29 (LM2993)
Plasmid#208959PurposeA variant CE1 construct with ePhi29 DNA polymerase (-exo), expressed from CMV or T7 promoters.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPCV2-XTEN-nSpCas9-BPNLS-ePhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); ePhi29(-exo)(D169A;M8R/V51A/M97T/…PromoterCMV and T7Available sinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
4784 TRV2-eTnpBc-reRNA4PDS
Plasmid#251816PurposeEditing Photene desaturase (PDS) genes in Nicotiana benthamianaDepositorInsertEnhanced variant of ISDra2 eTnpBc with guide targeting NbPDS with HDV at 3' end
TagsAtFDnlsExpressionPlantMutationN4Y/R110K/V192L/L222IAvailable sinceMarch 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-GT-Dox-AIO-TetOn_ETV2_Down-Tandem
Plasmid#241393PurposeBxb1-GT donor plasmid with downstream tandem syntax for all-in-one doxycycline-inducible expression of ETV2DepositorAvailable sinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
HaloTag-LacI-KRAB
Plasmid#232638Purposelac repressor (LacI) which binds lacO sites; labeled with HaloTag and coupled with Krüppel-associated box (KRAB) repressorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHaloTag-LacI-KRAB
TagsNLSExpressionMammalianMutationnonePromoterCMVAvailable sinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-dCas9/pMSCVneo
Plasmid#134982PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.DepositorInsert3xFLAG-dCas9
UseCRISPR and RetroviralTags3xFLAG tag and NLSExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterLTRAvailable sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRG711_lexO-AscI_LexA-TF_HIS3MX
Plasmid#154820PurposeInducible expression of AscI endonuclease in S. cerevisiaeDepositorInsertsAscI endonuclease
LexA-ER-B112
TagsFLAG and NLSExpressionYeastPromoterACT1 and lexO_4-CYC1_coreAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
B-SpCas9
Plasmid#126760PurposeExpression plasmid for human codon-optimized Blackjack-SpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than that of WT SpCas9.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertB-SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationamino acids 1005-1013 replaced with two glycinePromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEMS1136
Plasmid#29056PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable sinceNov. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1408
Plasmid#29205PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPle201 (SLC6A5 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSAvailable sinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1482
Plasmid#29235PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPle12 (AVP Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable sinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP779_αGCN4-VP64-CO
Plasmid#211772PurposeSunTag counterpart binding domain, αGCN4, fused to transcriptional activator VP64, with GFP selectionDepositorInsertaGCN4-VP64
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect VP64 e…PromoterpEF1a and pSV40Available sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only