pCY5k
(Plasmid
#160294)
-
PurposeYeast CRISPR plasmid targeting the kanMX cassette
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160294 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAS (Addgene #60847)
-
Backbone manufacturerJamie Cate
- Total vector size (bp) 10151
-
Vector typeCRISPR
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namesgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
-
SpeciesSynthetic
-
Insert Size (bp)379
Gene/Insert 2
-
Gene/Insert nameURA3 selection cassette
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1385
Gene/Insert 3
-
Gene/Insert namesgRNA expression cassette (without guide)
-
SpeciesSynthetic
-
Insert Size (bp)365
Gene/Insert 4
-
Gene/Insert nameCas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4176
-
Tags
/ Fusion Proteins
- SV40 NLS (C terminal on insert)
- 8xHis-tag (C terminal on insert)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCY5k was a gift from Amir Aharoni (Addgene plasmid # 160294 ; http://n2t.net/addgene:160294 ; RRID:Addgene_160294) -
For your References section:
Marker-free genetic manipulations in yeast using CRISPR/CAS9 system. Soreanu I, Hendler A, Dahan D, Dovrat D, Aharoni A. Curr Genet. 2018 Oct;64(5):1129-1139. doi: 10.1007/s00294-018-0831-y. Epub 2018 Apr 6. 10.1007/s00294-018-0831-y PubMed 29626221