We narrowed to 6,962 results for: pcDNA3.1+
-
Plasmid#240214PurposeMammalian vector for transient expression of theophylline-responsive MR-scRNA with mCherry transfection markerDepositorInsertTheophylline MR-scRNA targeting TET3G promoter
ExpressionMammalianPromoterU6Available sinceNov. 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
hVEGF165-eGFP-hVEGF165 glycosylation sequon-His tag
Plasmid#240484PurposeExpress engineered glycosylated eGFP in CHO cellsDepositorInsertglycosylated eGFP
Tags3 repeats of hVEGF165 glycosylation sequon, 6xHis…ExpressionMammalianAvailable sinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-huADF WT
Plasmid#245941PurposeExpressing wild type human actin depolymerizing factor (destrin)DepositorAvailable sinceNov. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Neo-2/15-TGFa-SPMn-SpyTag003
Plasmid#246650PurposeExpresses Neo-2/15-TGFa-SPMn-SpyTag003 in mammalian cells for calcium-induced NeissLock protein ligation to epidermal growth factor receptor (EGFR)DepositorInsertNeo-2/15-TGFa-SPMn-SpyTag003
TagsSignal peptide and SpyTag003ExpressionMammalianMutationConstruct contains the tPA signal peptide, Neo2/…PromoterCMV promoterAvailable sinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
tPA-TGFa-SPMn-SpyTag003
Plasmid#246649PurposeExpresses tPA-TGFa-SPMn-SpyTag003 in mammalian cells for calcium-induced NeissLock protein ligation to epidermal growth factor receptor (EGFR)DepositorInserttPA-TGFa-SPMn-SpyTag003
TagsSignal peptide and SpyTag003ExpressionMammalianMutationConstruct contains the tPA signal peptide, Kringl…PromoterCMV promoterAvailable sinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
huADF S3E
Plasmid#245944PurposeExpressing a non-actin binding form (phosphomimetic) of human ADFDepositorInsertactin depolymerizing factor (ADF) (DSTN Human)
ExpressionMammalianMutationS3EPromoterCMVAvailable sinceOct. 22, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
-
TVMV-HRV-3C Proteases-mCherry
Plasmid#243796PurposeEncodes for mammalian expression of TVMV and HRV-3C protease inputs. Construct contains a mCherry to indicate successful transfection and full plasmid read-through. Each protein is separated by a P2A self-cleaving sequence.DepositorInsertTVMV and HRV-3C proteases
ExpressionMammalianAvailable sinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
tdTomato-fMCP
Plasmid#238913PurposeContains tdTomato-fMCP fluorogenic proteinDepositorInserttdTomato-fMCP
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available sinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
TVMV Protease-mCherry
Plasmid#243794PurposeEncodes for mammalian expression of TVMV protease input. Construct contains a mCherry to indicate successful transfection and full plasmid read-through. Each protein is separated by a P2A self-cleaving sequence.DepositorInsertTVMV protease
ExpressionMammalianAvailable sinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
TVMV-TEV Proteases-mCherry
Plasmid#243797PurposeEncodes for mammalian expression of TVMV and TEV protease inputs. Construct contains a mCherry to indicate successful transfection and full plasmid read-through. Each protein is separated by a P2A self-cleaving sequence.DepositorInsertTVMV and TEV proteases
ExpressionMammalianAvailable sinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-R652A
Plasmid#240605PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2; R was substituted by A at Residue 652 of ACE2 in the collectrin-like siteDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsFLAG tagExpressionMammalianMutationArginine (R) at position 652 on ACE2 is replaced …PromoterCMVAvailable sinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-C4
Plasmid#240608PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2, so these amino acids were substituted by A at Cluster 4 located within the collectrin-like site on ACE2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsFLAG tagExpressionMammalianMutationArginine (R) and Lysine (K) residues on ACE2-clus…PromoterCMVAvailable sinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MasR-HA
Plasmid#240613PurposeEncodes MasR, a receptor on RAAS that antagonizes the AT1R physiological effects.DepositorAvailable sinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-P-SSP-AAA Mutant
Plasmid#238432PurposeExpress amino acid 631-650 of AAA Mutant GRP78 preceded by a secretory and sorting peptide of α-melanocyte-stimulating hormone (SSP)DepositorInsertamino acid 631-650 of AAA Mutant GRP78 preceded by a secretory and sorting peptide of α-melanocyte-stimulating hormone (SSP) (HSPA5 Human)
ExpressionMammalianAvailable sinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-P-SSP-Wild-Type
Plasmid#238431PurposeExpress amino acid 631-650 of Wild-type GRP78 preceded by a secretory and sorting peptide of α-melanocyte-stimulating hormone (SSP)DepositorInsertamino acid 631-650 of Wild-type GRP78 preceded by a secretory and sorting peptide of α-melanocyte-stimulating hormone (SSP) (HSPA5 Human)
ExpressionMammalianAvailable sinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-C1
Plasmid#240604PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2, so these amino acids were substituted by A at Cluster 1 located within the collectrin-like site on ACE2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsFLAG tagExpressionMammalianMutationArginine (R) and Lysine (K) residues on ACE2-clus…PromoterCMVAvailable sinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-C(3+4)
Plasmid#240611PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2, so these amino acids were substituted by A at Cluster 3 and Cluster 4 of ACE2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsFLAG tagExpressionMammalianMutationArginine (R) and Lysine (K) residues on both ACE2…PromoterCMVAvailable sinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-R671A
Plasmid#240606PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2; R was substituted by A at Residue 671 of ACE2 in the collectrin-like siteDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsFLAG tagExpressionMammalianMutationArginine (R) at position 671 on ACE2 is replaced …PromoterCMVAvailable sinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-DeltaC4
Plasmid#240609PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2 likely at Cluster 4 of ACE2 in the collectrin-like site. The whole C4 sequence was deleted in this mutantDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsFLAG tagExpressionMammalianMutationdeletion of the full Cluster 4 sequence on ACE2 (…PromoterCMVAvailable sinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only