We narrowed to 15,627 results for: jun
-
Plasmid#226479PurposepMOLC360_VR_I4 (Chloramphenicol R) containing the insert I4 to be assembled in POC1518 (pMOBK360_VL) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1539
Plasmid#226480PurposepMOLC360_VL_I5 (Chloramphenicol R) containing the insert I5 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1540
Plasmid#226481PurposepMOLC360_VM_I6 (Chloramphenicol R) containing the insert I6 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1541
Plasmid#226482PurposepMOLC360_VR_I7 (Chloramphenicol R) containing the insert I7 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1542
Plasmid#226483PurposepMOLC360_VL_I8 (Chloramphenicol R) containing the insert I8 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1543
Plasmid#226484PurposepMOLC360_VR_I9 (Chloramphenicol R) containing the insert I9 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1544
Plasmid#226485PurposepMOLC360_VL_I10 (Chloramphenicol R) containing the insert I10 to be assembled in POC1520 (pMOBK360_VR) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1545
Plasmid#226486PurposepMOLC360_VR_I11 (Chloramphenicol R) containing the insert I11 to be assembled in POC1520 (pMOBK360_VR) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1423
Plasmid#221559PurposePlasmid designed to assay the site-selective methylation protection approach using the non-switchable methylasesDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1426
Plasmid#221573PurposePlasmid containing the Insert 1 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1427
Plasmid#221574PurposePlasmid containing the Insert 2 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1428
Plasmid#221575PurposePlasmid containing the Insert 3 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1429
Plasmid#221576PurposePlasmid containing the Insert 4 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH916
Plasmid#230842PurposeEf1a-DivA-BE3-T2A-tagBFP-wPREDepositorInsertDivA-BE3
UseLentiviralExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mNeonGreen-G418
Plasmid#236484PurposePlasmid for deleting or C-terminally tagging endogenous genes with mNeonGreen and selection on G418.DepositorInsertmNeonGreen
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVEA3-delta7
Plasmid#234802PurposeMammalian expression of bovine arrestin-3 (deleted residues 176, 177, 178, 182-185)DepositorInsertArrestin-3 (ARR3 Bovine)
TagsVenusExpressionMammalianMutationdeleted residues 176, 177, 178, 182-185Available SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mStayGold-Hyg
Plasmid#236486PurposePlasmid for deleting or C-terminally tagging endogenous genes with mStayGold and selection on Hyg.DepositorInsertmStayGold
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mStayGold-Nat
Plasmid#236485PurposePlasmid for deleting or C-terminally tagging endogenous genes with mStayGold and selection on Nat.DepositorInsertmStayGold
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mStayGold-G418
Plasmid#236487PurposePlasmid for deleting or C-terminally tagging endogenous genes with mStayGold and selection on G418.DepositorInsertmStayGold
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only