We narrowed to 16,117 results for: grna
-
Plasmid#227778PurposeDestination vector with U6 driven 4 sgRNAsDepositorInsert4xU6:sgRNA
UseCRISPRPromoterU6Available sinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG13 sgRNA
Plasmid#207558PurposepX330 expressing Cas9 and a sgRNA targeting the ATG13 locusDepositorInsertggaaactgatctcaattccc
ExpressionMammalianPromoterCMV and U6Available sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA5_8xCTS-ECFP-pA
Plasmid#200247PurposeMammalian transfections; 8xCTS-ECFP reporter construct 5DepositorPublicationInsertsgRNA5_8xCTS
ExpressionMammalianAvailable sinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA3_8xCTS-ECFP-pA
Plasmid#200245PurposeMammalian transfections; 8xCTS-ECFP reporter construct 3DepositorPublicationInsertsgRNA3_8xCTS
ExpressionMammalianAvailable sinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA2_8xCTS-ECFP-pA
Plasmid#200244PurposeMammalian transfections; 8xCTS-ECFP reporter construct 2DepositorPublicationInsertsgRNA2_8xCTS
ExpressionMammalianAvailable sinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-vCASphi_E9t_V2_U6_AtPDS3_gRNA10
Plasmid#197963PurposeT-DNA binary vector to express pco-vCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by U6 promoter.DepositorInsertspco-vCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterAtU6-26 and pUBQ10Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-nCASphi_E9t_V2_CmYLCVp_35sT_ribozyme_AtPDS3_gRNA10
Plasmid#197980PurposeT-DNA binary vector to express pco-nCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by CmYLCVp, flanked by ribozymes.DepositorInsertspco-nCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterCmYLCVp and pUBQ10Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Sp(AU)sgRNA-mKO2
Plasmid#184443PurposesgRNA with AU flip (sgRNA2.0), mKO2 as selection markerDepositorInsertsgRNA with AU flip, mKO2
UseCRISPR and LentiviralExpressionMammalianAvailable sinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Exon-44_Dual_sgRNA
Plasmid#178096PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick exon-44 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + MTOR nick exon-44 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td2
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td1
Plasmid#176257PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 1DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7gRNA-smyhc1_977
Plasmid#140867PurposesgRNA synthesis vector for smyhc1_977 (zebrafish slow myosin heavy chain 1).DepositorInsertzebrafish smyhc1_977 sgRNA for in vitro transcription (smyhc1 Synthetic, Zebrafish)
UseIn vitro transcription of sgrnasAvailable sinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7gRNA-ccdb
Plasmid#140864PurposeBackbone for making sgRNAs.DepositorInsertccdb/CAM
UseGateway CloningAvailable sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_stgRNA-Puro
Plasmid#164124PurposeBackbone for lentiviral stgRNA library construction (library 1 and 2)DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_LMG18311_2xUGI_3xHA
Plasmid#136657PurposeExpresses St1BE4max-LMG18311 in mammalian cells along with its U6-driven sgRNADepositorInsertsUseCRISPR and Synthetic BiologyTags2xUGI, APOBEC-1, SV40 NLS, UGI, and hSt1Cas9ExpressionMammalianPromoterCAG and U6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_CNRZ1066_2xUGI_3xHA
Plasmid#136654PurposeExpresses St1BE4max-CNRZ1066 in mammalian cells along with its U6-driven sgRNADepositorInsertsUseCRISPR and Synthetic BiologyTags2xUGI, APOBEC-1, SV40 NLS, UGI, and hSt1Cas9ExpressionMammalianPromoterCAG and U6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLR5-U6-sgRNA-EF
Plasmid#82635PurposepiggyBac vector for expressing modified sgRNA in mammalian cellsDepositorTypeEmpty backboneUseCRISPR; Piggybac vectorExpressionMammalianPromoterU6Available sinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only