We narrowed to 24,635 results for: crispr
-
Plasmid#227309PurposeDonor template for mStayGold insertion into the C-terminus of the COX8A locus. For mitochondria visualization. To be co-transfected with sgRNAplasmid px330-PITCh-COX8A (Addgene #227308)DepositorInsertCOX8A Homology Arms flanking a mStayGold Tag (COX8A Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-COX8A
Plasmid#227308PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of COX8A for knock-in.DepositorInsertsgRNA Targeting C-terminus of COX8A (COX8A Human)
UseCRISPRExpressionMammalianPromoterU67Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7558 pHR (hU6-crB2M-EFS-PuroR-WPRE)
Plasmid#214881PurposeLentiviral vector encoding RfxCas13d targeting B2M guideDepositorInserthU6-crB2M-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCK340
Plasmid#192639PurposeExpresses dSpG and MCP-SoxS(R93A/S101A) on p15A-CmRDepositorInsertsSp.pCas9-dSpG
BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPR and Synthetic BiologyMutationSoxS has R93A and S101A mutations and dSpG has se…PromoterBBa_J23107 and Sp.pCas9Available SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRG01-U6-DR-crRNA-BsmbI(x2)-6T; EFS-Puro-2A-Fluc-WPRE
Plasmid#123362PurposeLentiviral vector with empty U6 cassette containing LbCpf1 direct repeat and U6 terminator, with constitutive expression of puromycin resistance and Firefly luciferase.DepositorInsertFirefly luciferase
UseCRISPR, Lentiviral, and LuciferaseExpressionMammalianPromoterEFSAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
AA364
Plasmid#215956PurposeFragmid fragment: (guide cassette) epegRNA expressionDepositorHas ServiceCloning Grade DNAInsertdU6:3_v1; BsmBI_v14; BsmBI_v15; evopreQ1_v1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Puro_siKO-2TO
Plasmid#86697PurposeTetracycline inducible (2TO version) expression of guide RNA targeted to AAVS1 locusDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterH1 2TOAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDonor-GDH
Plasmid#140629PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 and T7-GDH cargo gene.DepositorInsertMini-Tn6677, T7lac-GDH gene cassette
UseCRISPR; TransposonExpressionBacterialAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
HP-Cas9hGem-Ade2-LEU2-LINEAR
Plasmid#174839PurposepRS414 backbone containing LINEAR fragment targeting ADE2 in H. polymorphaDepositorInsertHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
UseCRISPR and Synthetic BiologyExpressionBacterial and YeastPromoterTDH3pAvailable SinceJan. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CETN2
Plasmid#227292PurposeDonor template for mStayGold insertion into the N-terminus of the CETN2 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CETN2 (Addgene #227291)DepositorInsertCETN2 Homology Arms flanking a mStayGold Tag (CETN2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-VIM
Plasmid#227302PurposeDonor template for mStayGold insertion into the C-terminus of the VIM locus. For intermediate filament visualization. To be co-transfected with sgRNA plasmid px330-PITCh-VIM (Addgene #227301)DepositorInsertVIM Homology Arms flanking a mStayGold Tag (VIM Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-FRT
Plasmid#113398Purposeexpresses gRNA for Cas9 FRT targettingDepositorInsertexo, beta, gam, sgRNA-FRT
UseCRISPRExpressionBacterialAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-dTAG-LMNB1
Plasmid#207776PurposeDonor template for Blast-2A-dTAG insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-dTAG Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-C-Solo-mStayGold-LAMP1
Plasmid#227322PurposeDonor template for mStayGold insertion into the C-terminus of the LAMP1 locus. For lysosome visualization. To be co-transfected with sgRNA plasmid px330-LAMP1 (Addgene #207787)DepositorInsertLAMP1 Homology Arms flanking a mStayGold Tag (LAMP1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-mRFP-; HE1A:BFP -0
Plasmid#180007PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-mRFP; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
SECURE miniABEmax-K20A/R21A (pJUL1774)
Plasmid#131312PurposeCMV promoter expression plasmid for bpNLS-TadA7.10(K20A/R21A)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS (miniABEmax with K20A/R21A mutations).DepositorInsertbpNLS-TadA7.10(K20A/R21A)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
ExpressionMammalianPromoterCMVAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHS71_10xHis_MBP_TEV_WT-Cas9_2xNLS
Plasmid#244833PurposeBacterial expression of SpyCas9 (WT) with 2xSV40 nuclear localization sequence for protein purificationDepositorInsertSpyCas9 (WT)
UseCRISPRTags10xHis-MBP and 2xSV40 NLSExpressionBacterialPromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-KalTA4-; HE1A:BFP -2
Plasmid#180012PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_CRATES
Plasmid#176251PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and type IIS restriction site for endonuclease BaeI at the crRNA region that facilitates the generation of mulitplDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only