We narrowed to 12,126 results for: LEA
-
Plasmid#182442PurposehSyncytin-1, furin cleavage site RNKR>AAAR(314-317)DepositorInsertERVW-1 (ERVW-1 Human)
ExpressionMammalianMutationfurin cleacage site RNKR>>AAAR(314-317)PromoterCMVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 Aro2+GFP
Plasmid#233001PurposeGalactose iduced expression of Gcn4 Aro2+GFP in yeastDepositorInsertGcn4 Aro2+
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationN116F, S117E, E119N, P129Q, T132YPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoED WHA
Plasmid#232995PurposeGalactose iduced expression of Gcn4 ILVtoED W+HAin yeastDepositorInsertGcn4 ILVtoED W+
Tags3xHA and TEV cleavage siteExpressionYeastMutationN126W, I128E, V130E, V135E, L137D, I142DPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 9acidA
Plasmid#232967PurposeGalactose iduced expression of Gcn4 9acidA in yeastDepositorInsertGcn4 9acidA
TagsTEV cleavage siteExpressionYeastMutationE109A, E111A, E114A, D115A, E119A, D125A, D127A, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 Aro3+GFP
Plasmid#233002PurposeGalactose iduced expression of Gcn4 Aro3+GFP in yeastDepositorInsertGcn4 Aro3+
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationD103Y, N112T, L113Y, S117F, K140RPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoED WGFP
Plasmid#233007PurposeGalactose iduced expression of Gcn4 LVtoED W+GFPin yeastDepositorInsertGcn4 ILVtoED W+
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationN126W, I128E, V130E, V135E, L137D, I142DPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJExpress401-KDAC8 D101N
Plasmid#224348PurposeExpresses human KDAC8 (HDAC8) D101N in E. coliDepositorInsertKDAC8 (HDAC8 Human)
TagsTEV-cleavable His6ExpressionBacterialMutationAspartate 101 mutated to asparaginePromoterT5Available SinceFeb. 19, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAGGS-PHOSPHO2-TEV-Twin-Strep
Plasmid#222016PurposeExpress human PHOSPHO2 protein (C-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-fusion protein (ENLYFQGS-WSHPQFEK-(GGGS)2-GGSA-WSHPQFEK)) in mammalian cellDepositorInsertPHOSPHO2 (PHOSPHO2 Human)
TagsTEV cleavable site and Twin-Strep-tagExpressionMammalianMutationdeleted stop codon (TAA)Promoterchicken β-actin promoterAvailable SinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-PHOSPHO2-TEV-Twin-Strep
Plasmid#222017PurposeExpress human PHOSPHO2 protein (C-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-fusion protein (ENLYFQGS-WSHPQFEK-(GGGS)2-GGSA-WSHPQFEK)) in E. coliDepositorInsertPHOSPHO2 (PHOSPHO2 Human)
TagsTEV cleavable site and Twin-Strep-tagExpressionBacterialMutationdeleted stop codon (TAA)Promoterlac promoterAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-myc:Rbx1:gs10:FRB:HA
Plasmid#228534PurposeHuman Rbx1 protein in fusion with FRB domain through a flexible glycine-serine linker.DepositorInsertmyc:Rbx1:gs10:FRB:HA (RBX1 Synthetic, Human)
TagsHA and mycExpressionMammalianPromoterCMVAvailable SinceDec. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk13_Nterm_FlagHa
Plasmid#127343PurposeN-terminal Flag- HA- tandem epitope tagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into Gateway entry vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UseEntry vector with transgene for gateway cloningTagsFlag- HA- Tandem EpitopesMutationBase pairs 1-1554 of transgene are codon optimize…PromoterNoneAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACE SOX (ORF37) D221N E244Q
Plasmid#192053PurposeExpresses a 2X catalytic mutant of (ORF37) D221N E244QDepositorInsertSOX (D221N E244Q)
UseUnspecifiedMutation2X catalytic mutant D221N E244QPromoterCMVAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACE SOX (ORF37) 318-320A
Plasmid#192054PurposeExpresses a mutant of SOX 318-320ADepositorInsertSOX (318-320A)
UseUnspecifiedMutationSOX 318-320APromoterCMVAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJExpress401-KDAC8 D101R
Plasmid#224349PurposeExpresses human KDAC8 (HDAC8) D101R in E. coliDepositorInsertKDAC8 (HDAC8 Human)
TagsTEV-cleavable His6ExpressionBacterialMutationAspartate 101 mutated to argininePromoterT5Available SinceOct. 28, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJExpress401-KDAC8 H143A
Plasmid#224342PurposeExpresses human KDAC8 (HDAC8) H143A in E. coliDepositorInsertKDAC8 H143A (HDAC8 Human)
TagsTEV-cleavable His6ExpressionBacterialMutationHistidine 143 mutated to alaninePromoterT5Available SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJExpress401-KDAC8 D101A
Plasmid#224347PurposeExpresses human KDAC8 (HDAC8) D101A in E. coliDepositorInsertKDAC8 (HDAC8 Human)
TagsTEV-cleavable His6ExpressionBacterialMutationAspartate 101 mutated to alaninePromoterT5Available SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETSUMO2_Ideonella-bGSDM-WELQ
Plasmid#222098PurposeFor expression of a mutant bacterial gasdermin (bGSDM) encoded by a Ideonella species with a WELQut protease cleavage site for controlled activation.DepositorInsertIdeonella-bGSDM-WELQ ORF
Tags6xHis-SUMO2ExpressionBacterialMutationN-terminal methionine deleted and replaced by sin…PromoterT7Available SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
PCDF Bravo-PotH-OL3/2sub
Plasmid#216752PurposeStudy the interaction of PotH in E. coli, specifically focusing on the variant in which outer loop 2 (OL2) is substituted with OL3 in its interaction with exogenous peptides.DepositorInsertpotH (potH E. coli (Bacteria))
Tags10x HisExpressionBacterialMutationOuter loop 2 (OL2) with the sequence of [WMGILKNN…Available SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFSynW SYT9 D197, 199N IRES GFP
Plasmid#195701PurposeLentiviral plasmid encoding SYT9 with D197, 199N mutations followed by an internal ribosomal entry site followed by EGFP under the human synapsin promoterDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only