We narrowed to 2,424 results for: dcas9
-
Bacterial strain#115926PurposeExpression of dCas9 gene under the control of a Ptet promoter in the E. coli chromosomeDepositorBacterial resistanceNoneAvailable sinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA
Plasmid#165450PurposeExpress N-terminal part of split dCas9-VPR and 3 sgRNAs targeting murine Opn1mw promoterDepositorInsertsdCas9N-IntN
3x Opn1mw promoter-targeting sgRNAs
UseAAV and CRISPRExpressionMammalianPromoterU6 and short human rhodopsin promoterAvailable sinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PB-tight-DDdCas9VPP300-T2A-GFP-IRES-Neo
Plasmid#102891PurposePiggyBac construct with doxycyline inducible TRE-tight promoter expression of TMP inducible DDdCas9VP192-P300core activator followed by T2A-EGFP as a reporter and IRES-Neo as selectionDepositorInsertDDdCas9VP192-P300-T2A-GFP-IRES-Neo
UseCRISPRExpressionMammalianMutationD10A, H840APromoterTRE-tightAvailable sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
KL301: pMAGIC (R4-R3) NLS-(SrfI/PmeI)-NLS-p300core
Plasmid#121839PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS/p300core scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseGateway Cloning and Synthetic BiologyAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LLP250 pEF1a-TALE-SunTag
Plasmid#100939PurposeEmpty TALE vector fused to SunTagx10 driven by EF1a promoter, with 3xHA tag, no PURO geneDepositorInsertTALE insertion site, SunTag array (10xGCN4)
UseTALENTags3xHAExpressionMammalianAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSelect-2
Plasmid#190242PurposeEncodes lacI-targeting gRNA for positive selection of dCas9 activity.DepositorInsertLacI
ExpressionBacterialAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
p5A1-Ti
Plasmid#92018PurposeExpresses TALE targeted to lac operator with 3 TEV cut sites in its repeat domain, anhydrotetracycline inducible catalytically inactive TEV proteaseDepositorInsertsTALE targeting lac operator with 3 TEV cleavage sites
Catalytically Inactive TEV Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219V, C151AAvailable sinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
LLP251 pEF1a-UNC5C-4-SunTag
Plasmid#100940PurposeTALE vector with UNC5C-4 insert fused to SunTagx10, driven by EF1a, with 3xHA tag, no PURO geneDepositorInsertTALE target sequence for UNC5C, SunTag array (10xGCN4)
UseTALENTags3xHAExpressionMammalianAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
SunTagCACTA1g2-22aa-TET1cd
Plasmid#106437PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the CACTA1 promoterDepositorInsertCACTA1gRNA2_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
FR-E01
Bacterial strain#118727PurposeExpression of dCas9 gene under the control of a Ptet promoter in the E. coli chromosomeDepositorBacterial resistanceNoneAvailable sinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOSIP-KL-mcherry
Plasmid#116947PurposeIntegrating mCherry into lambda attB in E. coli chromosome.DepositorInsertmcherry
Available sinceMarch 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-AIO-M11-gRNA-EFS-NMS-SadCas9
Plasmid#210710PurposeThis Plasmid express M11 promoter driven SadCas9 specific gRNA and EFS promoter driven NMS transactivation module fused to SadCas9DepositorInsertUseAAV and CRISPRTagsFLAGExpressionMammalianMutationD10A/N580APromoterM11Available sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1-PP7-boxB
Plasmid#75393PurposesgRNA1-PP7-boxBDepositorInsertsgRNA1-2XPP7-boxB
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available sinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLQ1870-1 pHR: U6-SpsgTRE3G CMV-mCherry
Plasmid#84248PurposeExpresses Sp sgTRE3G gRNA with a mCherry fluorescent markerDepositorInsertSp sgTRE3G
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1-boxB-MS2
Plasmid#75396PurposesgRNA1-boxB-MS2DepositorInsertsgRNA1-boxB-MS2
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available sinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBbdCas9H(-10TC)_arr2
Plasmid#149587Purposeparental, all-in-one CRISPRi vector for B. burgdorferi, parental for gRNA cloningDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaB, PpQE30Available sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(-10TC)_arr2
Plasmid#149582Purposeparental, all-in-one CRISPRi vector for B. burgdorferi, parental for gRNA cloningDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaB, PpQE30Available sinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only