We narrowed to 24,475 results for: crispr
-
Plasmid#138143PurposeExpresses PguCas13b in mammalian cells, localized in the nucleus. For cloning of guide RNAs compatible with PguCas13b. Contains a 3' direct repeat. Clone using BsmBI. F overhang cacc. R overhang caacDepositorInsertPguCas13b
UseLentiviralTagsNLSAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgNCKAP1-1
Plasmid#210133Purposeknock out NCKAP1 in mammalian cellsDepositorInsertNck-associated protein 1 (NCKAP1 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRCreb5gRNA
Plasmid#195021PurposeSequence specific sgRNA that guide Cas9 to the genomic region encoding the bovine Creb5 DNA binding domainDepositorAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS4: pHelper(AvCAST)_entry
Plasmid#168137PurposeInducible expression of AvCAST proteins. Two BsaI sites for spacer cloning.DepositorInsertsAvCAST minimal CRISPR array
AvCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
AvCAST Tns proteins (TnsA, TnsB, TnsC and TniQ)
AvTnsD
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-V2_mMSH2
Plasmid#186156PurposesgRNA targeting murine Msh2 geneDepositorAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFS_0385_pET30-RT-CRISPR_Rivularia_sp._PCC_7116_ARRAY_1
Plasmid#116997PurposeExpresses RPCC7116RT-Cas1-Cas2 under pT7lac promoter, encodes RPCC7116CRISPR array 1, compatible with SENECA acquisition readoutDepositorInsertRivularia sp. PCC 7116 RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFS_0387_pET30-RT-CRISPR_Rivularia_sp._PCC_7116_ARRAY_2
Plasmid#116999PurposeExpresses RPCC7116RT-Cas1-Cas2 under pT7lac promoter, encodes RPCC7116CRISPR array 2, compatible with SENECA acquisition readoutDepositorInsertRivularia sp. PCC 7116 RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFS_0388_pET30-RT-CRISPR_Rivularia_sp._PCC_7116_ARRAY_2_RC
Plasmid#117000PurposeExpresses RPCC7116RT-Cas1-Cas2 under pT7lac promoter, encodes RPCC7116CRISPR array 2 RC, compatible with SENECA acquisition readoutDepositorInsertRivularia sp. PCC 7116 RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFS_0386_pET30-RT-CRISPR_Rivularia_sp._PCC_7116_ARRAY_1_RC
Plasmid#116998PurposeExpresses RPCC7116RT-Cas1-Cas2 under pT7lac promoter, encodes RPCC7116CRISPR array 1 RC, compatible with SENECA acquisition readoutDepositorInsertRivularia sp. PCC 7116 RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFS_0347_pET30-RT-CRISPR_Campylobacter_fetus_subsp._Fetus_ARRAY_1
Plasmid#116959PurposeExpresses CfRT-Cas1-Cas2 under pT7lac promoter, encodes CfCRISPR array 1, compatible with SENECA acquisition readoutDepositorInsertCampylobacter fetus subsp. Fetus RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFS_0348_pET30-RT-CRISPR_Campylobacter_fetus_subsp._Fetus_ARRAY_1_RC
Plasmid#116960PurposeExpresses CfRT-Cas1-Cas2 under pT7lac promoter, encodes CfCRISPR array 1 RC, compatible with SENECA acquisition readoutDepositorInsertCampylobacter fetus subsp. Fetus RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_4
Plasmid#192688PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #4
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_1
Plasmid#192685PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #1
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_2
Plasmid#192686PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #2
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_3
Plasmid#192687PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #3
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1-sgSHMT1-G3
Plasmid#83903Purposestable knockoutDepositorInsertSerine hydroxymethyltransferase 1 (SHMT1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK384.4
Plasmid#155369PurposedCas9 + PA4-mVenusDepositorInsertsdCas9 (bacteria)
PA4-mVenus
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_TRBC
Plasmid#164994PurposeExpression of gRNA targeting TCRbeta constant locusDepositorInsertgRNA against TRBC
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only