PX458-sgEIF4EBP1
(Plasmid
#128097)
-
PurposeCRISPR gRNA against human EIF4EBP1 (4EBP1) with Cas9 from S. pyogenes and 2A-EGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128097 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePX458 (pSpCas9(BB)-2A-GFP)
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 9271
- Total vector size (bp) 9291
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCRISPR sgRNA against human 4EBP1
-
Alt nameEukaryotic translation initiation factor 4E-binding protein 1
-
Alt name4E-BP1
-
Alt name4EBP1
-
gRNA/shRNA sequenceTGAAGAGTCACAGTTTGAGA
-
SpeciesH. sapiens (human)
-
GenBank IDNM_004095
-
Entrez GeneEIF4EBP1 (a.k.a. 4E-BP1, 4EBP1, BP-1, PHAS-I)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer U6-Fwd primer (GAGGGCCTATTTCCCATGATTCC) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGeCKO sgRNA library (Shalem et al., 2014) and PX458 (pSpCas9(BB)-2A-GFP, Feng Zhang, Addgene plasmid #48138)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX458-sgEIF4EBP1 was a gift from Chi Van Dang (Addgene plasmid # 128097 ; http://n2t.net/addgene:128097 ; RRID:Addgene_128097) -
For your References section:
Acid Suspends the Circadian Clock in Hypoxia through Inhibition of mTOR. Walton ZE, Patel CH, Brooks RC, Yu Y, Ibrahim-Hashim A, Riddle M, Porcu A, Jiang T, Ecker BL, Tameire F, Koumenis C, Weeraratna AT, Welsh DK, Gillies R, Alwine JC, Zhang L, Powell JD, Dang CV. Cell. 2018 Jun 28;174(1):72-87.e32. doi: 10.1016/j.cell.2018.05.009. Epub 2018 May 31. 10.1016/j.cell.2018.05.009 PubMed 29861175