We narrowed to 3,621 results for: biorxiv
-
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pITESceIcmd
Plasmid#218288PurposeIntroduction of a cyanamide-inducible I-SceI expression cassette, use in combination with pITEdv1DepositorInsertHO(-253, -1)-tSynth3ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1-GST-TEV-NAP1
Plasmid#217610PurposeFor expression in E. coli of NAP1DepositorAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1-GST-TEV-GFP-NAP1
Plasmid#208870PurposeFor expression in E. coli of GFP-NAP1DepositorAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA15
Plasmid#199587PurposeContains guide RNA to 5' end of mouse EZH2 geneDepositorAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA16
Plasmid#199588PurposeContains guide RNA to 3' end of mouse EZH2 geneDepositorAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA17
Plasmid#199589PurposeContains guide RNA to 3' end of mouse EZH2 geneDepositorAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1067L
Plasmid#200253PurposepBac-U6-gRNA(doublesex+Intersex+bTublin)-3xp3-tdTomatoDepositorInsert6 gRNAs targeting Doublesex, Intersex, bTublin
ExpressionInsectAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pminiT-mEmerald-MED1 donor
Plasmid#197867PurposeDonor plasmid used for building mEmerald-MED1 knock-in mESCsDepositorAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTij_sg_mmu_Med6_C_terminal
Plasmid#197869PurposeCRISPR/Cas9/sgRNA plasmid for cutting Med6 C terminal and building MED6-mEmerald/Halo knock-in mESCsDepositorAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free NES (M)
Plasmid#182437PurposeYeast integrative plasmid for expressing ERG20(F96W-N127W) (GAL10 promoter) and AcNES1 (GAL7 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsFPPS(M)
NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH2 #7
Plasmid#166102PurposeThis plasmid express a sgRNA that targets the IDH2 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH2-135 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH1 #4
Plasmid#166101PurposeThis plasmid express a sgRNA that targets the IDH1 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH1-67 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
VEE-mScarlet3-IRES-E3-NSs-L*-EGFP-IRES-moxBFP
Plasmid#242410PurposeSelf-amplifying RNA (saRNA) construct expresses dsRNA pathway inhibitors (vaccinia virus E3, Toscana virus NSs, Theiler’s virus L*) and moxBFP (in place of inflammatory signaling inhibitors).DepositorInsertsmScarlet3
IRES-E3-NSs-L*-EGFP
IRES-moxBFP
UseMouse Targeting; Self-amplifying rnaExpressionMammalianAvailable SinceSept. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
PGK Promoter (MTK 2) (pAN2822)
Plasmid#194224PurposeMammalian Toolkit part 2 encoding the PGK promoterDepositorInsertPGK Promoter
UseSynthetic BiologyPromoterPGKAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOT_7-lenti-EFS-SS1-BBz-2A-puro
Plasmid#217990PurposeExpresses anti-Mesothelin CAR (with 4-1BB signaling domain) linked to puromycin resistance via P2A for lentiviral delivery.DepositorInsertSS1-BBz CAR
UseLentiviralAvailable SinceNov. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMV0067 [15ARE23bp -p(cFos)-fLuc-UBC-rLuc-P2A-GFP]
Plasmid#246421PurposeFirefly luciferase driven by an AHR responsive minimal cFOS promoter and a renilla luciferase and GFP driven by a constitutive UBC promoter flipped with respect to the lentiviral backboneDepositorInsertsFirefly luciferase
Renilla luciferase-P2A-EGFP
UseLentiviralExpressionMammalianPromoterAHR responsive minimal cFOS promoter and UbCAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSET-WHaloCaMP1a
Plasmid#205304PurposeExpression of WHaloCaMP1a in E. coliDepositorInsertWHaloCaMP1a
ExpressionBacterialAvailable SinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTipi2.1_Anti-Strep [IPI-C23.21] Mouse/Rabbit HC
Plasmid#221355PurposeMammalian expression of Anti-Strep [IPI-C23.21] Mouse/Rabbit HC; to be used with Anti-Strep [IPI-C23.21] light chain (Plasmid 221356) to make the antibody.DepositorInsertAnti-Strep [IPI-C23.21] Mouse/Rabbit HC
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTipi2.1_Anti-Rho IPI-[1D4] Mouse/Rabbit HC
Plasmid#221365PurposeMammalian expression of Anti-Rho IPI-[1D4] Mouse/Rabbit HC; to be used with Anti-Rho IPI-[1D4] light chain (Plasmid 221366) to make the antibody.DepositorInsertAnti-Rho IPI-[1D4] Mouse/Rabbit HC
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits