We narrowed to 3,822 results for: biorxiv
-
Plasmid#223158PurposeExpression of truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertMECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1307-AAV-EFSNC-dSaCas9-HP1b(79-173)
Plasmid#223152PurposeExpression of truncated HP1b with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 79-173PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1312-AAV-EFSNC-dSaCas9-KRAB
Plasmid#223157PurposeExpression of KRAB with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB
UseAAV and CRISPRTags3xFLAGExpressionMammalianPromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1311-AAV-EFSNC-dSaCas9-NIPP1(143-224)
Plasmid#223156PurposeExpression of truncated NIPP1 with dSaCas9 and empty gRNA scaffoldDepositorInsertNIPP1 (PPP1R8 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 143-224PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1310-AAV-EFSNC-dSaCas9-MBD2(176-231)
Plasmid#223155PurposeExpression of truncated MBD2 with dSaCas9 and empty gRNA scaffoldDepositorInsertMBD2 (MBD2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 176-231PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-SARS-CoV-2 5’UTR ΔSL1-Luciferase
Plasmid#191481PurposeLuciferase reporter for SARS-CoV-2 5' UTR ΔSL1DepositorInsertSARS-CoV-2 5' UTR ΔSL1
UseLentiviral and LuciferaseMutationMissing the stem-loop 1 region of SARS-CoV-2 5…Available SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-HA
Plasmid#242768PurposeAAV transfer plasmid expressing eGFP-HA under a CAG promoter.DepositorInsertEGFP
UseAAVTagsHAPromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-ALFA
Plasmid#242764PurposeAAV transfer plasmid expressing eGFP-ALFA under a CAG promoter.DepositorInsertEGFP
UseAAVTagsALFAPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-MYC
Plasmid#242771PurposeAAV transfer plasmid expressing eGFP-MYC under a CAG promoter.DepositorInsertEGFP
UseAAVTagsMYCPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
Anti-pTau nanobody (A2) with sortase tag
Plasmid#233218PurposeMammalian epression of anti-pTau nanobody (A2) with a sortase tag for direct dye conjugation.DepositorInsertAnti-pTau nanobody (A2)
TagsSortase tag, His tagExpressionMammalianAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-sgCTG-CAG-Cas9D10A nickase-Blast
Plasmid#216733PurposeExpresses SpCas9-D10A nickase under a CAG promoter together with a blasticidin resistance gene, along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Suitable for lentivirus packaging.DepositorArticleInsertCas9-D10A nickase and sgCTG
UseCRISPR and LentiviralExpressionMammalianMutationD10APromoterU6 and CAGAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX551-miniCMV-SpCas9D10A nickase
Plasmid#216735PurposeExpresses SpCas9-D10A nickase from a miniCMV promoter. For AAV packaging. Derived from pX551-miniCMV-SpCas9, which was a gift from Alex Hewitt (Addgene #107031)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterT7 and mini-CMVAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_122
Plasmid#208095PurposePerturb-Seq lentiviral gRNA expression vector with a 3' appended capture sequence to enable direct capture of CRISPR gRNAs for scRNA-seqDepositorInsertPuromycin resistance
UseCRISPR and LentiviralPromoterEF1aAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
hETFDH CRISPR_1
Plasmid#232309PurposeHuman ETFDH Gene Knockout (gRNA 1)DepositorInsertETFDH-targeting gRNA (ETFDH Human)
UseLentiviralAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
mEtfdh CRISPR_2
Plasmid#232313PurposeMouse Etfdh Gene Knockout (gRNA 2)DepositorInsertEtfdh-targeting gRNA (Etfdh Mouse)
UseLentiviralAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
mEtfdh CRISPR_1
Plasmid#232312PurposeMouse Etfdh Gene Knockout (gRNA 1)DepositorInsertEtfdh-targeting gRNA (Etfdh Mouse)
UseLentiviralAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
hETFDH CRISPR_2
Plasmid#232310PurposeHuman ETFDH Gene Knockout (gRNA 2)DepositorInsertETFDH-targeting gRNA (ETFDH Human)
UseLentiviralAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST40-mPTER
Plasmid#224864PurposeMammalian expression mouse PTER proteinDepositorAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET20b-mPTER
Plasmid#222189PurposeBacterial expression of mouse PTER proteinDepositorAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only