We narrowed to 24,475 results for: crispr
-
Plasmid#209031PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-As
Plasmid#209032PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-As
Plasmid#209033PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAC1801_pmax-dCasRx
Plasmid#118634PurposeTransient transfection; Expresses dCasRx; CAGGS promoterDepositorInsertdCasRx
ExpressionMammalianMutationR239A/H244A/R858A/H863APromoterCAGGSAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJC005.em
Plasmid#182738PurposeCRISPR-Cas12a genome editing of E. faeciumDepositorTypeEmpty backboneUseCRISPRAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCT-tRNA
Plasmid#133813PurposeCRISPR-Cas9 system for genetic manipulation of Candida tropicalisDepositorInsertcassette for the expression of the sgRNA from the Ashbya gossypii RNA pol II TEF1 promoter
UseCRISPRAvailable SinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMB70
Plasmid#47943PurposeCan be used to express a CRISPR guide RNA in C. elegans from U6 regulatory sequencesDepositorInsertguide RNA
UseCRISPRExpressionWormAvailable SinceOct. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pV1382
Plasmid#111436PurposeS. cerevisiae and C. glabrata Solo CRISPR vector, marked with URA3 and NatRDepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFYF1548 EMX1
Plasmid#47508Purposehuman gRNA expression vector targeting EMX1DepositorAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pC0045-EF1a-PguCas13b-NES-HIV
Plasmid#103861PurposeExpresses PguCas13b in mammalian cells for knockdown of target RNAs in combination with compatible guide RNAs. Localized to the cytoplasmDepositorInsertPguCas13b
UseCRISPR and LentiviralTags3xHA and HIV NESExpressionMammalianAvailable SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas9-polyA
Plasmid#72602Purposeexpress hCas9 byT7 promoter with polyadenine tailsDepositorInsertCas9-polyadenine
Tags81-bp polyadenylationPromoterT7Available SinceJuly 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJJR81
Plasmid#75029PurposetagBFP2^SEC^3xFlag vector with ccdB markers for cloning homology armsDepositorInserttagBFP2^SEC^3xFlag
UseCRISPRTags3xFLAG and C. elegans codon optimized tagBFP2ExpressionWormAvailable SinceJune 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
HEK4-53bp-tag-insertion-pegRNA
Plasmid#227673PurposePegRNA for 53 bp insertionDepositorAvailable SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpG_ATH51-IP
Plasmid#242074PurposeExpresses Cas9-SpG_ATH51 in mammalian cellsDepositorInsertSpG_ATH51
UseCRISPRExpressionMammalianMutationectopic insertion of 7 amino acids of PID turn-he…Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGG438
Plasmid#165486PurposeVector for expression of the SpCas9 VRKG variant in human cells: CMV-T7-humanVRKG(SpCas9, D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFLAGDepositorInsertMammalian codon-optimized Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFlag
UseCRISPRTags3x FLAG and SV40 NLSExpressionMammalianMutationD1135V, S1136R, D1332K, and R1333G mutations in S…PromoterCMV and T7Available SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCCM935
Plasmid#58202PurposeExpresses unc-22 sgRNA in C.elegans. Can be used in Co-CRISPR experiments.DepositorInsertunc-22 sgRNA
ExpressionWormPromoterU6Available SinceJuly 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330-HypaCas9
Plasmid#108302PurposepX330 (Plasmid #42230) with the N692A, M694A, Q695A, and H698A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
EC2_3_dCas9_Mxi1_sgRNA
Plasmid#163708PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and Mxi1 transcriptional repressorDepositorInsertsdCas9
Mxi1+SV40 NLS
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only