We narrowed to 14,982 results for: egf
-
Plasmid#13601DepositorInsertintegrin alpha 9 / alpha 2 (ITGA9 Human)
TagsGFPExpressionMammalianMutationIntegrin alpha 9 chimera containing the cytoplasm…Available sinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSB-CMV-MCS-Puro cPLA2-mK2-P2A-EGFP-LaminB1
Plasmid#162566PurposeUsed for the dual color labeling of cPLA2 and LaminB1 expression.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNATagsEGFP, P2A, and mKate2ExpressionMammalianPromoterCMV and SV40Available sinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
EF1α-TetOn3G_2x cHS4_pTRE3G-loxP-EGFP-lox2272 [AAVS1]
Plasmid#227246PurposeAll-in-one ROSE LP donor construct for TetOn3G-inducible cell line development in HEK293 cellDepositorInsertsTet-On 3G transactivator protein
Enhanced green fluorescent protein
UseCre/Lox and Synthetic BiologyExpressionMammalianPromoterEF1α and pTRE3GAvailable sinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-TeNT-P2A-EGFP
Plasmid#176282PurposeViral vector for co-expression of TeNT and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertTeNT-P2A-EGFP
UseAAV and Cre/LoxExpressionMammalianPromoterhuman Synapsin IAvailable sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19-TgKI-MCS-p2A-eGFP-MCS-polyA
Plasmid#174028PurposeThis plasmid is used for generating C-terminal knock-in plasmid and/or PCR donors in zebrafish.DepositorInsertp2A-eGFP
UseZebrafish knock-in taggingAvailable sinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
P-Ef1a-RPL22-3XFlag-P2A-EGFP-T2A-Puro
Plasmid#170318PurposeExpresses FLAG and EGFP tagged RPL22, puromycin resistanceDepositorAvailable sinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1mismatch
Plasmid#10881DepositorPublicationAvailable sinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-N1 BLTP3A
Plasmid#241247PurposeFor exogenous expression of codon optimized BLTP3A (UHRF1BP1) as a C-terminal fusion to EGFP in mammalian cellsDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBLTP3A (UHRF1BP1) (BLTP3A Human)
TagsEGFPExpressionMammalianAvailable sinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-DNAJC13(FL)
Plasmid#246660PurposeMammalian expression of full length, eGFP tagged DNAJC13DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDNAJC13 (DNAJC13 Human)
TagseGFPExpressionMammalianPromoterCMVAvailable sinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRPML1-EGFP
Plasmid#245039PurposeExpresses TRPML1 with C-terminus EGFP tag in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTRPML1 (MCOLN1 Human)
TagsEGFPExpressionMammalianAvailable sinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAVEC2_C-mEGFP
Plasmid#231295PurposeFor transiently expressing fusion proteins with C terminally tagged mEGFP in plants (includes p19 silencing suppressor)DepositorTypeEmpty backboneTagsmEGFPExpressionPlantMutationN/AAvailable sinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-fMCP
Plasmid#238908PurposeContains EGFP-fMCP fluorogenic proteinDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEGFP-fMCP
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFPc3 N-RAS
Plasmid#236450Purposetransient overexpression of N-RAS in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertN-RAS (NRAS Human)
ExpressionMammalianAvailable sinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_TetON_EGFP-NPM1
Plasmid#237661PurposeFor integration of EGFP-NPM1DepositorAvailable sinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
peGFP NOVA2 op
Plasmid#224354PurposeExpress GFP-tagged human NOVA2 (codon optimized)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNOVA2 (NOVA2 Human)
TagseGFPExpressionMammalianMutationcodon optimized for expression in human cellsPromoterCMV and T7Available sinceSept. 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-C1-BBS7
Plasmid#218715PurposeExpresses N-terminally EGFP-tagged BBS7 in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBBS7 (BBS7 Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-BBS2
Plasmid#218712PurposeExpresses N-terminally EGFP-tagged BBS2 in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBBS2 (BBS2 Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-EGFP
Plasmid#166140PurposeEGFP expression under the control of the Galactose-inducible promoter yeast. Contains CEN/ARS element for low copy within yeast.DepositorInsertEGFP
ExpressionYeastPromoterGAL1Available sinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
eGFP-SUN1ΔN
Plasmid#213508PurposeExpresses human eGFP-SUNΔN in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserteGFP-SUNΔN (SUN1 Human)
ExpressionMammalianMutationSUN1ΔN has the first 138 amino acid (lamina domai…PromoterCMVAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGS140_6xHis-EGFP-I3-01
Plasmid#211889PurposeBacterial expression of I3-01DepositorInsertI3-01
ExpressionBacterialMutationN/AAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only