We narrowed to 4,633 results for: IRES
-
Plasmid#190154PurposeExpresses dominant-negative Vamp3 (rat Vamp3 AA 1-81) plus membrane-targeted EGFP in oligodendrocytes; AAV vectorDepositorInsertVamp3 (Vamp2 Rat)
UseAAVTagsP2AT2A-EGFP-caaxExpressionMammalianMutationTruncation that includes only rat Vamp3 AA #1-81PromoterMBPAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmAGO1-RB_B
Plasmid#145977PurposeInsect Expression of DmAGO1-RBDepositorInsertDmAGO1-RB (AGO1 Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUASp-Flag-Myc-Qin-Tudor-attB
Plasmid#44210DepositorInsertQin-Tudor-domain (qin Fly)
UseFly transformationTagsFlag and MycMutationlacks E3 domain on N-term (del aa1-274)Available SinceOct. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7 Delta WD40 (-2 to 7)
Plasmid#197454PurposeThe plasmid expresses delta WD40 deleted version of Myc-tagged FBW7 human isoform 1. WD40 propellars 2 to 7 are deleted. Used for mammalian overexpression and detection by western blotting.DepositorInsertFBW7 Delta-WD40 propeller (FBXW7 Human)
TagsMycExpressionMammalianMutationFBW& dimerization domain deleted.PromoterCMVAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Ascl1 x2)
Plasmid#171099PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Ascl1.DepositorAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-rB90
Plasmid#18959DepositorInsertBrevican C-terminus (Bcan Rat)
ExpressionMammalianMutationRat brevican C-terminus: Signal peptide aa 1-22 …Available SinceDec. 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2TK-WW-CR-W3083F/P3086A
Plasmid#18077DepositorInsertDystrophin (DMD Human)
TagsGSTExpressionBacterialMutationSecond conserved Tryptophan (W) of the WW domain …Available SinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2TK-WW-CR-d-ZZ-W3083F/P3086A
Plasmid#18079DepositorInsertDystrophin (DMD Human)
TagsGSTExpressionBacterialMutationSecond conserved Tryptophan (W) of the WW domain …Available SinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLV-PB2_Lock1-I436C+S993C
Plasmid#182879PurposeLentivirus for expression of Plexin-B2 locked ring mutantDepositorInserthPLXNB2 (PLXNB2 Human)
UseLentiviralMutationchanged Isoleucine 436 to Cysteine and Serine 993…Available SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-PB2_Lock2-I436C+T1051C
Plasmid#182880PurposeLentivirus for expression of Plexin-B2 locked ring mutantDepositorInserthPLXNB2 (PLXNB2 Human)
UseLentiviralMutationchanged Isoleucine 436 to Cysteine and Threonine …Available SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only