We narrowed to 8,750 results for: Dos
-
Plasmid#119743PurposeExpresses TVA, V5, and RG in a cre dependent manner.DepositorInsertTVA, V5, Rabies Glycoprotein
UseAAV and Cre/LoxTagsV5Available SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1(-) mouse Egr2
Plasmid#107997PurposeExpresses mouse Egr2 in mammalian cellsDepositorAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-GpA
Plasmid#191238PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of GpA and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), GYPA (GPA) (E(transmembrane)R)
Tagsnuclease A from S. aureus fused to the TM domain …ExpressionBacterialMutationChanged Alanine 112 to CysteinePromoterT7 promoterAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Gβ-2A-cpV-Gγ2-IRES-Gαi3-mTq2
Plasmid#69625PurposeA FRET sensor for Galphai3 activation, encoded on a single plasmid.DepositorInsertsGbeta-2A-cpV-Ggamma2
Galphai3-mTurquoise2
Tagsciruclar permutated Venus (cp173V) and mTurquoise…ExpressionMammalianPromoterCMV and CMV (IRES)Available SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIDS-RESTwt full-length
Plasmid#109161PurposeEncodes human full-length REST/NRSF to be expressed in a baculovirus/insect cell expression systemDepositorAvailable SinceJan. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSBbi G418 Hu Her2
Plasmid#183246PurposeExpression of human HER2 antigen in a Sleeping Beauty transposon vectorDepositorInsertHer2 (ERBB2 Human)
ExpressionMammalianAvailable SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG_V5-PPP6C
Plasmid#92013PurposeExpresses V5-PPP6C, includes IRES-EmeraldDepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR V5-RNF14_IRES-mCherry
Plasmid#198384PurposeRNF14 expressionDepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR V5-RNF14 C417A_IRES-mCherry
Plasmid#198385PurposeRNF14 C417A expressionDepositorInsertRNF14 (RNF14 Human)
UseLentiviralTagsV5ExpressionMammalianMutationcatalytic cysteine mutation (C417A)PromoterEF1AAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T_mouseH3.1-HaloTag
Plasmid#244242PurposeCRISPR/Cas9 donor plasmid to tag mouse histone H3.1 with Halo tagDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSET mNG-GECO1
Plasmid#201933PurposeExpresses mNG-GECO1 indicator in bacteriaDepositorInsertmNeonGreenGECO1
TagsHIS tagExpressionBacterialAvailable SinceAug. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETM33_EIF4E_eiF4E
Plasmid#178474PurposeBacterial expression of human domain with His-tag and GST tagDepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-CoRESTfl
Plasmid#109156PurposeEncodes human full-length CoREST with C-terminal 3xFLAG tag to be expressed in a baculovirus/insect cell expression systemDepositorInserthuman full-length CoREST, sequence-optimized for insect cells (RCOR1 Human)
Tags3xFLAGExpressionInsectPromoterPolyhedrinAvailable SinceJan. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF_L58R
Plasmid#101775PurposeExpresses mutant BAF (L58R) in human cells (with EGFP produced from the same transcript as expression control)DepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFP-P2AExpressionMammalianMutationL58R mutationPromoterEF1aAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX304 3xFlag-eRF1_IRES-GFP
Plasmid#198393PurposeeRF1 expressionDepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaM-6
Plasmid#172771PurposeBacterial expression of anti-mCherry nanobody LaM-6, with pelB leader and C-term free cysteine and 6xHIS tag.DepositorInsertLaM-6
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSMP-EZH2_2
Plasmid#36388DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
p3e UbB polyA
Plasmid#188702PurposeGateway 3' element encoding the ubiquitin B polyadenylation sequenceDepositorAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCh-LgBiT-2A-EGFP-Vin-PILATeS
Plasmid#216761PurposePiggyBac vector for stable co-expression of mCherry-LgBiT and EGFP-Vinculin-PILATeS (700 pM) in mammalian cells. Requires transposaseDepositorInsertmCherry-LgBiT-P2A-T2A-EGFP-Vin-PILATeS
TagsEGFP and mCherryExpressionMammalianAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only