We narrowed to 890 results for: Px330
-
Plasmid#207759PurposeDonor template for moxGFP-2A-Zeo insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertH2BC11 Homology Arms flanking a moxGFP-Zeo Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Puro-mScarlet-ACTB
Plasmid#207754PurposeDonor template for Puro-2A-mScarlet insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertACTB Homology Arms flanking a Puro-mScarlet Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 16, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Blast-mNeon-ACTB
Plasmid#207751PurposeDonor template for Blast-2A-mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertACTB Homology Arms flanking a Blast-mNeon Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mNeon-Blast-TUBB4B
Plasmid#207786PurposeDonor template for mNeon-2A-Blast insertion into the C-terminus of the TUBB4B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBB4B Addgene #207785DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTUBB4B Homology Arms flanking a mNeon-Blast Cassette (TUBB4B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H2BC11-MMEJ
Plasmid#207760PurposeMMEJ donor template for moxGFP-2A-Puro insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertH2BC11 Short Homology Arms flanking a moxGFP-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Puro-moxGFP-TUBA1B
Plasmid#207767PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTUBA1B Homology Arms flanking a Puro-moxGFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Blast-sTagRFP-TUBA1B
Plasmid#207768PurposeDonor template for Blast-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTUBA1B Homology Arms flanking a Blast-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Puro-sTagRFP-TUBA1B
Plasmid#207769PurposeDonor template for Puro-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTUBA1B Homology Arms flanking a Puro-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-C-Solo-mStayGold-EZR
Plasmid#227294PurposeDonor template for mStayGold insertion into the C-terminus of the EZR locus. For membrane visualization. To be co-transfected with sgRNA plasmid px330-EZR (Addgene #227293)DepositorInsertEZR Homology Arms flanking a mStayGold Tag (EZR Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-H3C2
Plasmid#227334PurposeDonor template for mStayGold insertion into the C-terminus of the H3C2 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 (Addgene #207780)DepositorInsertH3C2 Homology Arms flanking a mStayGold Tag (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-miRFP670nano3-H3C2
Plasmid#227335PurposeDonor template for miRFP670nano3 insertion into the C-terminus of the H3C2 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 (Addgene #207780)DepositorInsertH3C2 Homology Arms flanking a miRFP670nano3 Tag (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-miRFP670nano3-H2BC11
Plasmid#227331PurposeDonor template for miRFP670nano3 insertion into the C-terminus of the H2BC11 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 (Addgene #207755)DepositorInsertH2BC11 Homology Arms flanking a miRFP670nano3 Tag (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-MAP4
Plasmid#227296PurposeDonor template for mStayGold insertion into the N-terminus of the MAP4 locus. For microtubule visualization. To be co-transfected with sgRNAplasmid px330-PITCh-MAP4 (Addgene #227295)DepositorInsertMAP4 Homology Arms flanking a mStayGold Tag (MAP4 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-ARL13B
Plasmid#227277PurposeDonor template for mStayGold insertion into the C-terminus of the ARL13B locus. For cilia visualization. To be co-transfected with sgRNA plasmid pX330-PITCh-ARL13B (Addgene #227276)DepositorInsertARL13B Homology Arms flanking a mStayGold Tag (ARL13B Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-miniTurbo-LMNB1
Plasmid#207774PurposeDonor template for Blast-2A-miniTurbo insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-miniTurbo Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Blast-V5-LMNB1
Plasmid#207779PurposeDonor template for Blast-2A-V5 insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-V5 Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-C-Solo-mScarlet-H3C2
Plasmid#207781PurposeDonor template for mScarlet insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a mScarlet Tag (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Solo-mNeon-ACTB
Plasmid#207749PurposeDonor template for mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a mNeon Tag (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mScarlet-MAPRE1
Plasmid#227323PurposeDonor template for mScarlet insertion into the C-terminus of the MAPRE1 locus. For growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 (Addgene #207793)DepositorInsertMAPRE1 Homology Arms flanking a mScarlet Tag (MAPRE1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only