A versatile plasmid architecture for mammalian synthetic biology (VAMSyB).
Haellman V, Strittmatter T, Bertschi A, Stucheli P, Fussenegger M
Metab Eng. 2021 Jul;66:41-50. doi: 10.1016/j.ymben.2021.04.003. Epub 2021 Apr 18. PubMed Article
Haellman V, Strittmatter T, Bertschi A, Stucheli P, Fussenegger M
Metab Eng. 2021 Jul;66:41-50. doi: 10.1016/j.ymben.2021.04.003. Epub 2021 Apr 18. PubMed Article
Plasmids from Article
ID | Plasmid | Purpose |
---|---|---|
169477 | pVH8-Tier1-PhCMV-NLS | Tier-1 vector encoding PhCMV-driven nuclear localization signal expression (PhCMV-NLS-pA). |
169478 | pVH9-Tier1-PhCMV-3xNLS | Tier-1 vector encoding PhCMV-driven triple nuclear localization signal expression (PhCMV-3xNLS-pA). |
169479 | pTS2378-Tier1-PhCMV-KDEL | Tier-1 vector encoding PhCMV-driven ER-retention signal KDEL (PhCMV-KDEL-pA). |
169481 | pTS2412-Tier1-PPGK-2xGS | Tier-1 vector encoding PPGK-controlled 2x (GGGGS)-linker (PPGK-2xGS-pA). |
169482 | pTS2415-Tier1-PPGK-1xEAAAK | Tier-1 vector encoding PPGK-controlled 1x (AEAAAK)-linker (PPGK-AEAAAK-pA). |
169484 | pTS2379-Tier1-PhCMV-PEST | Tier-1 vector encoding PhCMV-driven PEST tag for destabilization of proteins (PhCMV-PEST-pA). |
169485 | pTS2380-Tier1-PhCMV-TM | Tier-1 vector encoding PhCMV-driven transmembrane domain from Junctophilin-1 (TM) (PhCMV-TM-pA). |
169486 | pMM585-Tier1-PhCMV-Igk | Tier-1 vector encoding PhCMV-driven secretion signal Igk (PhCMV-Igk-pA). |
169487 | pTS2381-Tier1-PhCMV-Igk_TM | Tier-1 vector encoding PhCMV-driven transmembrane domain from Junctophilin-1 (TM) for membrane localization of fusion proteins attached to a secretion signal Igk (PhCMV-IgkSS-TM-pA). |
169488 | pTS2409-Tier1-PhCMV-FURINsite | Tier-1 vector encoding PhCMV-controlled FURIN protease recognition site (PhCMV-FURINsite-pA). |
169489 | pVH17-Tier1-PhCMV-myr | Tier-1 vector encoding PhCMV-driven myristoylation (myr) signal peptide expression (PhCMV-myr-pA). |
169490 | pTS1051-Tier1-PhCMV-4xCox8 | Tier-1 vector encoding PhCMV-driven four-fold repeat of a mitochondrial matrix localization signal derived from mitochondrial matrix protein Cox8 (PhCMV-4xCox8-pA) |
169491 | pTS1018-Tier1-PhCMV-p2A | Tier-1 vector encoding a self-cleaving peptides p2a sequence (PhCMV-p2A-pA). |
169492 | pTS1021-Tier1-PhCMV-PuroR | Tier-1 vector encoding PhCMV-driven marker for puromycin selection (PhCMV-PuroR-pA) |
169493 | pTS2401-Tier1-PhCMV-HygroR | Tier-1 vector encoding PhCMV-driven hygromycin resistance gene HygroR (PhCMV-HygroR-pA). |
169494 | pTS2402-Tier1-PhCMV-BlastR | Tier-1 vector encoding PhCMV-driven blasticidin resistance gene BlastR (PhCMV-BlastR-pA). |
169495 | pTS2403-Tier1-PhCMV-ZeoR | Tier-1 vector encoding PhCMV-driven zeocin resistance gene ZeoR (PhCMV-ZeoR-pA). |
169496 | pTS2404-Tier1-PhCMV-NeoR | Tier-1 vector encoding PhCMV-driven neomycin resistance gene NeoR (PhCMV-NeoR-pA). |
169497 | pTS1023-Tier1-PhCMV-p2A-PuroR | Tier-1 vector encoding PhCMV-driven p2A sequence fused to a marker for puromycine selection (PhCMV-p2A-PuroR-pA). |
169498 | pTS1047-Tier1-PhCMV-YPet-p2A-PuroR | Tier-1 vector encoding PhCMV-driven YPet in combination with a marker for puromycin selection (PhCMV-YPet-p2A-PuroR-pA). |
169499 | pTS1024-Tier1-PRPBSA-YPet-p2A-PuroR | Tier-1 vector encoding PRPBSA-driven YPet in combination with a marker for puromycine selection (PRPBSA-YPet-p2A-PuroR-pA) |
169500 | pTS2405-Tier1-PhCMV-TEV | Tier-1 vector encoding PhCMV-driven tabacco etch virus protease TEV (PhCMV-TEV-pA). |
169501 | pTS2406-Tier1-PhCMV-NTEV | Tier-1 vector encoding PhCMV-driven N-terminal fragment of a split tabacco etch virus protease splitTEV (PhCMV-N-TEV-pA). |
169503 | pTS2408-Tier1-PhCMV-TEVsite | Tier-1 vector encoding PhCMV-controlled tabacco etch virus protease recognition site (PhCMV-TEVsite-pA). |
169505 | pMM545-Tier1-PhCMV-Citrine | Tier-1 vector encoding PhCMV-driven yellow fluorescent protein Citrine (PhCMV-Citrine-pA). |
169506 | pFOX8-Tier1-PhCMV-YPet | Tier-1 vector encoding PhCMV-driven YPet expression (PhCMV-YPet-pA). |
169508 | pFOX11-Tier1-PhCMV-Clover | Tier-1 vector encoding PhCMV-driven gren fluorescent protein clover (PhCMV-clover-pA). |
169509 | pFOX12-Tier1-PhCMV-eGFP | Tier-1 vector encoding PhCMV-driven green fluorescent protein eGFP (PhCMV-eGFP-pA). |
169510 | pFOX13-Tier1-PhCMV-tGFP | Tier-1 vector encoding PhCMV-driven green fluorescent protein turbo GFP (PhCMV-tGFP-pA). |
169511 | pFOX14-Tier1-PhCMV-mTFP1 | Tier-1 vector encoding PhCMV-driven green fluorescent protein mTFP1 (PhCMV-mTFP1-pA). |
169512 | pFOX15-Tier1-PhCMV-mTurquoise2 | Tier-1 vector encoding PhCMV-driven green fluorescent protein mTurquoise2 (PhCMV-mTurquoise2-pA). |
169515 | pFOX6-Tier1-PhCMV-TdTomato | Tier-1 vector encoding PhCMV-driven bright-red fluorescent protein TdTomato (PhCMV-TdTomato-pA). |
169517 | pTS2384-Tier1-PhCMV-medFT | Tier-1 vector encoding PhCMV-driven delayed-maturing fluorescent protein fluorescent timer (FT) with "medium" maturation medFT (PhCMV-medFT-pA). |
169518 | pTS2385-Tier1-PhCMV-fastFT | Tier-1 vector encoding PhCMV-driven delayed-maturing fluorescent protein fluorescent timer (FT) with "fast" maturation fastFT (PhCMV-fastFT-pA). |
169519 | pTS2386-Tier1-PhCMV-GCaMP6s | Tier-1 vector encoding PhCMV-driven calcium sensor GCaMP6s (PhCMV-GCaMP6s-pA). |
169520 | pVH231-Tier1-PmPGK1-mTagBFP2 | Tier-1 vector encoding PmPGK1-driven mTagBFP2 expression (PmPGK1-mTagBFP2-pA). |
169521 | pVH230-2-Tier1-PmPGK1-YPet | Tier-1 vector encoding PmPGK1-driven YPet expression (PmPGK1-YPet-pA). |
169522 | pVH233-Tier1-PmPGK1-eYFP | Tier-1 vector encoding PmPGK1-driven eYFP expression (PmPGK1-eYFP-pA). |
169523 | pVH232-Tier1-PmPGK1-mRuby2 | Tier-1 vector encoding PmPGK1-driven mRuby2 expression (PmPGK1-mRuby2-pA). |
169524 | pTS2387-Tier1-PhCMV-p2a_mTagBFP2 | Tier-1 vector encoding PhCMV-driven blue fluorescent protein mTagBFP2 fused to a "self-cleaving" peptide p2a (PhCMV-p2a_mTagBFP2-pA). |
169525 | pTS2388-Tier1-PhCMV-p2a_Ypet | Tier-1 vector encoding PhCMV-driven yellow fluorescent protein YPet fused to a "self-cleaving" peptide p2a (PhCMV-p2a_YPet-pA). |
169526 | pTS2389-Tier1-PhCMV-p2a_mRuby | Tier-1 vector encoding PhCMV-driven red fluorescent protein mRuby2 fused to a "self-cleaving" peptide p2a (PhCMV-p2a_mRuby2-pA). |
169529 | pTS2392-Tier1-PhCMV-p2a_medFT | Tier-1 vector encoding PhCMV-driven delayed-maturing fluorescent protein fluorescent timer (FT) with "medium" maturation medFT fused to a "self-cleaving" peptide p2a (PhCMV-p2a_medFT-pA). |
169530 | pTS2393-Tier1-PhCMV-p2a_fastFT | Tier-1 vector encoding PhCMV-driven delayed-maturing fluorescent protein fluorescent timer (FT) with "fast" maturation fastFT fused to a "self-cleaving" peptide p2a (PhCMV-p2a_medFT-pA). |
169531 | pTS2394-Tier1-PhCMV-3xNLS_mTagBFP2 | Tier-1 vector encoding PhCMV-driven blue fluorescent protein mTagBFP2 with nuclear localization (PhCMV-3xNLS-mTagBFP2-pA). |
169532 | pTS1026-Tier1-PhCMV-3xNLS-iRFP670 | Tier-1 vector encoding PhCMV-driven iRFP670 that is localized to the nucleus (PhCMV-3xNLS-iRFP670-pA). |
169533 | pTS2395-Tier1-PhCMV-Igk_mRuby2_KDEL | Tier-1 vector encoding PhCMV-driven red fluorescent protein mRuby2 localized to the ER (PhCMV-Igk-mRuby2-KDEL-pA). |
169534 | pTS2396-Tier1-PhCMV-4xCOX8_Ypet | Tier-1 vector encoding PhCMV-driven yellow fluorescent protein YPet localized to the mitochondria (PhCMV-4xCOX8-YPet-pA). |
169535 | pTS2410-Tier1-PhCMV-Myr_mTagBFP2 | Tier-1 vector encoding PhCMV-controlled plasma membrane-tethered mTagBFP2 (PhCMV-myr-mTagBFP2-pA). |
169537 | pTS1046-Tier1-PhCMV-4xCox8-mRuby2 | Tier-1 vector encoding PhCMV-driven mRuby2 localized to the mitochondrial matrix via a four-fold Cox8 localization signal (PhCMV-4xCox8-mRuby2-pA) |
169543 | pVH608-Tier1-PmPGK1-Fluc | Tier-1 vector encoding PmPGK1-driven Fluc (PmPGK1-Fluc-pA). |
169544 | pVH41-Tier1-PhCMV-GLuc | Tier-1 vector encoding PhCMV-driven gaussia luciferase (PhCMV-GLuc-pA) |
169545 | pTS1011-Tier1-PhCMV-Nluc | Tier-1 vector encoding PhCMV-driven NLuc (PhCMV-NLuc-pA). |
169548 | pTS2303-Tier1-CoTC-PPGK-NLuc_TB | Tier-1 expression vector encoding PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' CoTC insulator sequence (CoTC-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA). |
169549 | pTS2304-Tier1-Tactb-PPGK-NLuc_TB | Tier-1 expression vector encoding PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' Tactb insulator sequence (Tactb-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA). |
169550 | pTS2307-Tier1-2xcHS4-PPGK-NLuc_TB | Tier-1 expression vector encoding PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a tandem repeat of a 5' cHS4 insulator sequence (2xcHS4-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA). |
169551 | pTS2308-Tier1-pGL3-PPGK-NLuc_TB | Tier-1 expression vector encoding PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' insulator sequence derived from the pGL3 plasmid (pGL3-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA). |
169552 | pTS2311-Tier1-spacer-PPGK-NLuc_TB | Tier-1 expression vector encoding PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 preluded by a 5' spacer sequence (spacer-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA). |
169557 | pVH63-Tier1-PMLP-Citrine_p2a_SEAP | Tier-1 vector encoding PMLP-driven Citrine-p2A-SEAP expression (PMLP-Citrine-p2A-SEAP-pA). |
169558 | pVH64-Tier1-PSV40-Citrine_p2a_SEAP | Tier-1 vector encoding PSV40-driven Citrine-p2A-SEAP expression (PSV40-Citrine-p2A-SEAP-pA). |
169559 | pVH65-Tier1-PTK-Citrine_p2a_SEAP | Tier-1 vector encoding PTK-driven Citrine-p2A-SEAP expression (PTK-Citrine-p2A-SEAP-pA). |
169560 | pVH72-Tier1-PhCMV-SEAP | Tier-1 vector encoding PhCMV-driven SEAP expression containing a computationally optimized secretion peptide (PhCMV-SEAP-pA). |
169561 | pVH21-Tier1-PhEF1a | Tier-1 PhEF1a-driven expression vector (PhEF1a-MCS-pA). |
169562 | pTS2364-Tier1-IRES | Tier-1 vector carrying an internal ribosome entry site (IRES-pA) |
169563 | pVH227-Tier1-OTetO7-PCMVmin2-SEAP | Tier-1 vector encoding PTetO7-driven SEAP expression (OTetO7-PCMVmin-2-SEAP-pA). |
169564 | pVH228-Tier1-OVanO2-PCMVmin2-SEAP | Tier-1 vector encoding PVanO2-driven SEAP expression (OVanO2-PCMVmin-2-SEAP-pA). |
169565 | pVH229-Tier1-OTtgO2-PCMVmin2-SEAP | Tier-1 vector encoding PTtgO2-driven SEAP expression (OTtgO2-PCMVmin-2-SEAP-pA). |
169566 | pTS2365-Tier1-PhCMV-TetR | Tier-1 vector encoding PhCMV-driven tetracycline dependent regulator protein TetR (PhCMV-TetR-pA). |
169567 | pTS2366-Tier1-PhCMV_F-type | Tier-1 vector encoding PhCMV-driven F-type transactivator domain (PhCMV-F-type-pA). |
169568 | pTS2367-Tier1-PhCMV_VP16 | Tier-1 vector encoding PhCMV-driven VP16 transactivator domain (PhCMV-VP16-pA). |
169569 | pTS2368-Tier1-PhCMV_VP64 | Tier-1 vector encoding PhCMV-driven VP64 transactivator domain (PhCMV-VP64-pA). |
169570 | pVH15-Tier1-PhCMV-VPR | Tier-1 vector encoding PhCMV-driven VP64-P65-Rta expression (PhCMV-VPR-pA) |
169571 | pTS2369-Tier1-PhCMV_KRAB | Tier-1 vector encoding PhCMV-driven KRAB transsilencer domain (PhCMV-KRAB-pA). |
169572 | pVH19-Tier1-PhCMV-p300core | Tier-1 vector encoding PhCMV-driven histone acetyltransferase p300 core domain expression (PhCMV-p300core-pA) |
169573 | pTS2370-Tier1-PhCMV-TetR_F-type | Tier-1 vector encoding PhCMV-driven tetracycline-dependent F-type-based transactiavtor (PhCMV-TetR-F-type-pA). |
169574 | pVH234-Tier1-PmPGK1-tTA | Tier-1 vector encoding PmPGK1-driven tTA expression (PmPGK1-tTA-pA). |
169575 | pAB303-Tier1-PhCMV-TetR_VPR | Tier-1 vector encoding PhCMV-driven tetracycline-dependent VPR-based transactiavtor (PhCMV-TetR-VPR-pA). |
169577 | pAB300-Tier1-PhCMV-rTetR | Tier-1 vector encoding PhCMV-driven tetracycline-activated rTetR (PhCMV-rTetR-VPR-pA). |
169578 | pVH235-Tier1-PmPGK1-rtTA | Tier-1 vector encoding PmPGK1-driven rtTA expression (PmPGK1-rtTA-pA). |
169579 | pAB301-Tier1-PhCMV-rTetR_VPR | Tier-1 vector encoding PhCMV-driven tetracycline-activated VPR-based transactiavtor (PhCMV-rTetR-VPR-pA). |
169581 | pTS2373-Tier1-PhCMV-Gal4 | Tier-1 vector encoding PhCMV-driven Gal4 DNA binding domain (PhCMV-Gal4-pA). |
169582 | pTS2374-Tier1-PhCMV-Gal4_VP16 | Tier-1 vector encoding PhCMV-driven Gal4-VP16 transactivator (PhCMV-Gal4-VP16-pA). |
169584 | pVH237-2-Tier1-PmPGK1-TtgA | Tier-1 vector encoding PmPGK1-driven TtgA expression (PmPGK1-TtgA-pA). |
169585 | pVH254-Tier1-OTetO7-Pmin-SEAP | Tier-1 vector encoding PTetO7-driven SEAP expression (OTetO7-Pmin-SEAP-pA). |
169586 | pTS1017-Tier1-OTetO7-PCMVmin-SEAP | Tier-1 vector encoding PTetO7-driven SEAP (OTetO7-PCMVmin-SEAP-pA). |
169587 | pVH255-Tier1-OTetO7-PCMVmin1-SEAP | Tier-1 vector encoding PTetO7-driven SEAP expression (OTetO7-PCMVmin-1-SEAP-pA). |
169588 | pVH265-Tier1-OTetO7-PCMVmin2-TS-SEAP | Tier-1 vector encoding PTetO7-driven SEAP expression with a suppressor 5'UTR (OTetO7-PCMVmin-2-5'UTRTS-SEAP-pA). |
169589 | pVH266-Tier1-OTetO7-PCMVmin2-SEAP-sTRSV | Tier-1 vector encoding PTetO7-driven SEAP expression with a 3'UTR sTRSV ribozyme (OTetO7-PCMVmin-2-SEAP-3'UTRsTRSV-pA). |
169590 | pVH267-Tier1-OTetO7-PCMVmin2-SEAP-env140 | Tier-1 vector encoding PTetO7-driven SEAP expression with a 3'UTR env140 ribozyme (OTetO7-PCMVmin-2-SEAP-3'UTRenv140-pA). |
169591 | pVH268-Tier1-OTetO7-PCMVmin2-SEAP-p2A-iRFP670 | Tier-1 vector encoding PTetO7-driven SEAP-p2A-iRFP670 expression (OTetO7-PCMVmin-2-SEAP-p2A-iRFP670-pA). |
169592 | pVH270-Tier1-OTtgO2-PCMVmin2-SEAP-p2A-iRFP670 | Tier-1 vector encoding PTtgO2-driven SEAP-p2A-iRFP670 expression (OTtgO2-PCMVmin-2-SEAP-p2A-iRFP670-pA). |
169594 | pVH607-Tier1-PCREm4-Nluc | Tier-1 vector encoding PCREm4-driven Nluc expression (PCREm4-Nluc-pA). |
169595 | pVH321-1-Tier1-PhCMV-dCas9-3xNLS | Tier-1 vector encoding PhCMV-driven dCas9-3xNLS expression (PhCMV-dCas9-3xNLS-pA). |
169596 | pVH321-2-Tier1-PhCMV-NLS-dCas9-3xNLS | Tier-1 vector encoding PhCMV-driven NLS-dCas9-3xNLS expression (PhCMV-NLS-dCas9-3xNLS-pA). |
169597 | pVH333-1-Tier1-PhCMV-dCas9-3xNLS-VP64 | Tier-1 vector encoding PhCMV-driven dCas9-3xNLS-VP64 expression (PhCMV-dCas9-3xNLS-VP64-pA). |
169599 | pVH1001-Tier2(ColE1 ori) | Tier-2 expression vector (A1-pA::A2-pA::A3-pA). The tier-2 expression vector consists of a custom MCS cassette containing the three Tier-1 compatible acceptor cassettes (A1, A2, and A3) each with its own non-homologous polyadenylation (pA) signals in a minimal backbone (AmpR and ColE1 ori). |
169600 | pVH1002-Tier2(pUC ori) | Tier-2 expression vector (A1-pA::A2-pA::A3-pA). The tier-2 expression vector consists of a custom MCS cassette containing the three Tier-1 compatible acceptor cassettes (A1, A2, and A3) each with its own non-homologous polyadenylation (pA) signals in a minimal backbone (AmpR and pUC ori). |
169602 | pVH613 | Tier-2 vector encoding PCREm4-driven Nluc and PmPGK1-driven Fluc expression (PCREm4-Nluc-pA::A2-pA::PmPGK1-Fluc-pA). |
169603 | pVH614 | Tier-2 vector encoding PmPGK1-driven Fluc and PCREm4-driven Nluc expression (PmPGK1-Fluc-pA::PCREm4-Nluc-pA::A3-pA). |
169604 | pVH615 | Tier-2 vector encoding PCREm4-driven Nluc and PmPGK1-driven Fluc expression (A1-pA::PCREm4-Nluc-pA::PmPGK1-Fluc-pA). |
169605 | pVH616 | Tier-2 vector encoding PmPGK1-driven Fluc and PCREm4-driven Nluc expression (PmPGK1-Fluc-pA::A2-pA::PCREm4-Nluc-pA). |
169606 | pVH617 | Tier-2 vector encoding PmPGK1-driven Fluc and PCREm4-driven Nluc expression (A1-pA::PmPGK1-Fluc-pA::PCREm4-Nluc-pA). |
169607 | pVH663 | Tier-2 vector encoding PTetO7-driven SEAP-p2A-iRFP670, PmPGK1-driven tTA and PmPGK1-driven YPet expression (PTetO7-CMVmin-2-SEAP-p2A-iRFP670-pA::PmPGK1-tTA-pA::PmPGK1-YPet-pA). |
169608 | pVH664 | Tier-2 vector encoding PTetO7-driven SEAP-p2A-iRFP670, PmPGK1-driven rtTA and PmPGK1-driven YPet expression (PTetO7-CMVmin-2-SEAP-p2A-iRFP670-pA::PmPGK1-rtTA-pA::PmPGK1-YPet-pA). |
169610 | pVH666 | Tier-2 vector encoding PTtgO2-driven SEAP-p2A-iRFP670, PmPGK1-driven TtgA and PmPGK1-driven mRuby2 expression (PTtgO2-CMVmin-2-SEAP-p2A-iRFP670-pA::PmPGK1-TtgA-pA::PmPGK1-mRuby2-pA). |
169611 | pTS1031 | Tier-2 vector encoding PhCMV-driven secreted Nluc (PhCMV-IgkSS-Nluc-pA::A2-pA::A3-pA). |
169612 | pTS1032 | Tier-2 vector encoding PhCMV-driven secreted Nluc (A1-pA::PhCMV-IgkSS-Nluc-pA::A3-pA). |
169613 | pTS1033 | Tier-2 vector encoding PhCMV-driven secreted Nluc (A1-pA::A2-pA::PhCMV-IgkSS-Nluc-pA). |
169614 | pTS1035 | Tier-2 vector encoding PmPGK1-driven secreted Nluc (PmPGK1-IgkSS-Nluc-pA::A2-pA::A3-pA). |
169615 | pTS1036 | Tier-2 vector encoding PmPGK1-driven secreted Nluc (A1-pA::PmPGK1-IgkSS-Nluc-pA::A3-pA). |
169616 | pTS1037 | Tier-2 vector encoding PmPGK1-driven secreted Nluc (A1-pA::A2-pA::PmPGK1-IgkSS-Nluc-pA). |
169617 | pTS1039 | Tier-2 vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::A3-pA). |
169618 | pTS1040 | Tier-2 vector encoding PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (A1-pA::PPGK-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA). |
169619 | pTS1041 | Tier-2 vector encoding PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (A1-pA::A2-pA::PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA). |
169620 | pTS1042 | Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (PhCMV-SEAP-p2A-iRFP670-pA::PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA). |
169621 | pTS1043 | Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::PPGK-IgkSS-Nluc-p2A-mTagBFP2-pA) . |
169622 | pTS2312 | Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' CoTC insulator sequence (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::CoTC-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA). |
169624 | pTS2317 | Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' insulator sequence derived from the pGL3 plasmid (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::pGL3-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA). |
169625 | pTS2320 | Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 preluded by a 5' spacer sequence (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::spacer-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA). |
169626 | pTS2321 | Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' CoTC insulator sequence (PhCMV-SEAP-p2A-iRFP670-pA::CoTC-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA). |
169627 | pTS2322 | Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' Tactb insulator sequence (PhCMV-SEAP-p2A-iRFP670-pA::Tactb-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA). |
169628 | pTS2326 | Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' insulator sequence derived from the pGL3 plasmid (PhCMV-SEAP-p2A-iRFP670-pA::pGL3-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA). |
169629 | pTS2329 | Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 preluded by a 5' spacer sequence (PhCMV-SEAP-p2A-iRFP670-pA::spacer-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA). |
169630 | pgTS40 | pX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19. |
169632 | pTS2163 | Tier-3 vector for CRISPR-mediated stable integration into the AAVS1 locus of the tetON-system (OTetO7-PCMVmin-SEAP-p2A-iRFP670-pA::PmPGK1-rtTA-pA::A3-pA) |
169633 | pTS395_PhCMV-SB100 | Expression vector encoding PhCMV driven SB100 sleeping beauty transposase (PhCMV-SB100-pA) |
169634 | pTS1107_Tier3(SB) | Tier-3 vector for stable integration of up to three cassettes via sleeping beauty transposase (5'ITR-A1-pA::A2-pA::A3-pA-3'ITR) |
169635 | pTS2337_Tier3(SB)-TagBFP2_Puro | Tier-3 vector for stable integration of up to three cassettes via sleeping beauty transposase including a TagBFP marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-mTagBFP2-p2A-PuroR-pA-3'ITR) |
169637 | pTS2339_Tier3(SB)-Ruby_Puro | Tier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a mRuby2 marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-mRuby2-p2A-PuroR-pA-3'ITR) |
169638 | pTS2340_Tier3(SB)-iRFP_Puro | Tier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a iRFP670 marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-iRFP670-p2A-PuroR-pA-3'ITR) |
169639 | pTS2341_Tier3(SB)-Puro | Tier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-PuroR-pA-3'ITR) |
169641 | pTS2343_Tier3(SB)-YPet_Blast | Tier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a YPet marker and BlastR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-YPet-p2A-BlastR-pA-3'ITR) |
169642 | pTS2344_Tier3(SB)-mRuby2_Blast | Tier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a mRuby marker and BlastR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-mRuby2-p2A-BlastR-pA-3'ITR) |
169648 | pTS2351_Tier3(SB)-Zeo | Tier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a ZeoR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-ZeoR-pA-3'ITR) |
169649 | pTS1019_Tier3(PB) | Tier-3 vector for stable integration of up to three cassettes via piggyBac transposase (ITR-A1::A2::A3-ITR) |
169652 | pTS2353_Tier3(PB)-YPet_PuroR | Tier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a YPet marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-YPet-p2A-PuroR-pA-3'ITR) |
169653 | pTS2354_Tier3(PB)-Ruby_PuroR | Tier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a mRuby2 marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-mRuby2-p2A-PuroR-pA-3'ITR) |
169654 | pTS2355_Tier3(PB)-iRFP_PuroR | Tier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a iRFP670 marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-iRFP670-p2A-PuroR-pA-3'ITR) |
169655 | pTS2356_Tier3(PB)-PuroR | Tier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-PuroR-pA-3'ITR) |
169656 | pTS2357_Tier3(PB)-TagBFP_BlastR | Tier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a mTagBFP2 marker and BlastR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-mTagBFP2-p2A-BlastR-pA-3'ITR) |
169657 | pTS2361_Tier3(SB)-rtTA-YPet_PuroR | Tier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a YPet marker and PuroR resistance gene and a PPGK-driven rtTA transactivator (5'ITR-A1-pA::PPGK-rtTA-pA::PRPBSA-YPet-p2A-PuroR-pA-3'ITR) |
169658 | pTS2362_Tier3(SB)-rtTA-PuroR | Tier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a PuroR resistance gene and a PPGK-driven rtTA transactivator (5'ITR-A1-pA::PPGK-rtTA-pA::PRPBSA-PuroR-pA-3'ITR) |
169659 | pTS2363_Tier3(PB)-rtTA-YPet_PuroR | Tier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a YPet marker and PuroR resistance gene and a PPGK-driven rtTA transactivator (5'ITR-A1-pA::PPGK-rtTA-pA::PRPBSA-YPet-p2A-PuroR-pA-3'ITR) |
169661 | pTS1106_Tier3(Lenti) | Tier-3 vector for stable integration of up to three cassettes via lentiviral transduction (PCMV-5'LTR-Psi-gag-env-A1::A2::A3-WPRE-3'LTR) |
169663 | pTS1108_Tier3(Lenti_inverse) | Tier-3 vector for stable integration of up to three cassettes via lentiviral transduction in inverted direction with polyA (PCMV-5'LTR-Psi-gag-env-A3-pA::A2-pA::A1-pA-WPRE-3'LTR) |
169664 | pTS2333_Tier3(Lenti_inverse)-YPet_Puro | Tier-3 vector for stable integration via lentiviral transduction in inverted direction with polyA carrying a constitutive expression cassette for puromyine and Ypet (PCMV-5'LTR-Psi-gag-env-PRPBSA-YPet-p2A-PuroR-pA::A2-pA::A3-pA-WPRE-3'LTR) |
169665 | pTS2334_Tier3(Lenti_inverse)-rtTA-YPet_Puro | Tier-3 vector for lentiviral stable integration of the rtTA and puromyine - Ypet selection cassette in inverted direction with polyA (PRPBSA-YPet-p2a-PuroR::PPGK-rtTA-pA::A3-pA) |
169667 | pVH269-Tier1-OVanO2-PCMVmin2-SEAP-p2A-iRFP670 | Tier-1 vector encoding PVanO2-driven SEAP-p2A-iRFP670 expression (OVanO2-PCMVmin-2-SEAP-p2A-iRFP670-pA). |