pTS2353_Tier3(PB)-YPet_PuroR
(Plasmid
#169652)
-
PurposeTier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a YPet marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-YPet-p2A-PuroR-pA-3'ITR)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169652 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTS1019 (pUC57-based)
- Backbone size w/o insert (bp) 3092
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePRPBSA-driven YPet and PuroR expression
-
Alt nameA1::A2::PRBSA-YPet-p2a-PuroR
-
SpeciesSynthetic; E. coli
- Promoter PRPBSA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer AmpStart
- 3′ sequencing primer CTGGCACGACAGGTTTCCCGACTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTS2353_Tier3(PB)-YPet_PuroR was a gift from Martin Fussenegger (Addgene plasmid # 169652 ; http://n2t.net/addgene:169652 ; RRID:Addgene_169652) -
For your References section:
A versatile plasmid architecture for mammalian synthetic biology (VAMSyB). Haellman V, Strittmatter T, Bertschi A, Stucheli P, Fussenegger M. Metab Eng. 2021 Jul;66:41-50. doi: 10.1016/j.ymben.2021.04.003. Epub 2021 Apr 18. 10.1016/j.ymben.2021.04.003 PubMed 33857582