pVH615
(Plasmid
#169604)
-
PurposeTier-2 vector encoding PCREm4-driven Nluc and PmPGK1-driven Fluc expression (A1-pA::PCREm4-Nluc-pA::PmPGK1-Fluc-pA).
-
Depositing Lab
-
Depositing OrganizationETH Zurich (Swiss Federal Institute of Technology)
Located in Switzerland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169604 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 169604-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 169604-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepVH1002 (pUC57-based)
- Backbone size w/o insert (bp) 2689
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePPGK-driven FLuc Luciferase expression cassette and cAMP response element-controlled NanoLuc Luciferase expression cassette
-
Alt namePCRE-NLuc
-
Alt namePPGK-FLuc
-
SpeciesSynthetic; Photinus pyralis
- Promoter PCREm4 / PPGK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer AmpStart
- 3′ sequencing primer CTGGCACGACAGGTTTCCCGACTGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 169604-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 169604-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVH615 was a gift from Martin Fussenegger (Addgene plasmid # 169604 ; http://n2t.net/addgene:169604 ; RRID:Addgene_169604) -
For your References section:
A versatile plasmid architecture for mammalian synthetic biology (VAMSyB). Haellman V, Strittmatter T, Bertschi A, Stucheli P, Fussenegger M. Metab Eng. 2021 Jul;66:41-50. doi: 10.1016/j.ymben.2021.04.003. Epub 2021 Apr 18. 10.1016/j.ymben.2021.04.003 PubMed 33857582