Skip to main content

pVH615
(Plasmid #169604)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169604 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pVH1002 (pUC57-based)
  • Backbone size w/o insert (bp) 2689
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PPGK-driven FLuc Luciferase expression cassette and cAMP response element-controlled NanoLuc Luciferase expression cassette
  • Alt name
    PCRE-NLuc
  • Alt name
    PPGK-FLuc
  • Species
    Synthetic; Photinus pyralis
  • Promoter PCREm4 / PPGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer AmpStart
  • 3′ sequencing primer CTGGCACGACAGGTTTCCCGACTGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVH615 was a gift from Martin Fussenegger (Addgene plasmid # 169604 ; http://n2t.net/addgene:169604 ; RRID:Addgene_169604)
  • For your References section:

    A versatile plasmid architecture for mammalian synthetic biology (VAMSyB). Haellman V, Strittmatter T, Bertschi A, Stucheli P, Fussenegger M. Metab Eng. 2021 Jul;66:41-50. doi: 10.1016/j.ymben.2021.04.003. Epub 2021 Apr 18. 10.1016/j.ymben.2021.04.003 PubMed 33857582