Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pB-GLUT4-7myc-GFP
(Plasmid #52872)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 52872 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pB
  • Backbone manufacturer
    Bogan lab, unpublished
  • Backbone size w/o insert (bp) 5783
  • Modifications to backbone
    The vector is based on pMX except that it contains mutations (ATG to GTG) at 1564 and at 1072 to eliminate potential start sites upstream of the cloning site.
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GLUT4
  • Alt name
    SLC2A4
  • Alt name
    solute carrier family 2
  • Species
    R. norvegicus (rat); with human c-terminus
  • Entrez Gene
    Slc2a4 (a.k.a. Glut4)
  • Tags / Fusion Proteins
    • 7x-myc (internal) (N terminal on insert)
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer MX1 CCACCGCCCTCAAAGTAGACG
  • 3′ sequencing primer MX2 CCCCTTTTTCTGGAGACTAAAT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Plasmid is also called pB-G7. We use FACS to select infected cells that express GFP. There is a short linker between GLUT4 and GFP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pB-GLUT4-7myc-GFP was a gift from Jonathan Bogan (Addgene plasmid # 52872 ; http://n2t.net/addgene:52872 ; RRID:Addgene_52872)
  • For your References section:

    Insulin-responsive compartments containing GLUT4 in 3T3-L1 and CHO cells: regulation by amino acid concentrations. Bogan JS, McKee AE, Lodish HF. Mol Cell Biol. 2001 Jul;21(14):4785-806. 10.1128/MCB.21.14.4785-4806.2001 PubMed 11416153