-
Purposedetection and measurement of GLUT4 translocation
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52872 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepB
-
Backbone manufacturerBogan lab, unpublished
- Backbone size w/o insert (bp) 5783
-
Modifications to backboneThe vector is based on pMX except that it contains mutations (ATG to GTG) at 1564 and at 1072 to eliminate potential start sites upstream of the cloning site.
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGLUT4
-
Alt nameSLC2A4
-
Alt namesolute carrier family 2
-
SpeciesR. norvegicus (rat); with human c-terminus
-
Entrez GeneSlc2a4 (a.k.a. Glut4)
-
Tags
/ Fusion Proteins
- 7x-myc (internal) (N terminal on insert)
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer MX1 CCACCGCCCTCAAAGTAGACG
- 3′ sequencing primer MX2 CCCCTTTTTCTGGAGACTAAAT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid is also called pB-G7. We use FACS to select infected cells that express GFP. There is a short linker between GLUT4 and GFP.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB-GLUT4-7myc-GFP was a gift from Jonathan Bogan (Addgene plasmid # 52872 ; http://n2t.net/addgene:52872 ; RRID:Addgene_52872) -
For your References section:
Insulin-responsive compartments containing GLUT4 in 3T3-L1 and CHO cells: regulation by amino acid concentrations. Bogan JS, McKee AE, Lodish HF. Mol Cell Biol. 2001 Jul;21(14):4785-806. 10.1128/MCB.21.14.4785-4806.2001 PubMed 11416153